CU088656 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGTTTGAGGAAATCAATGGTGGGAATGCTTTCGAGGACATCCCAAAACGCAGCCTACCATTGACACTTTGCCTTATGACTTCGAGTTTCAATATCTTTTGCCTTTGTAAAATCTAATTCTTTAAATTTGAGGAATAATCAATTATTTGGATAAGGGGTTCTTTTTTTCATTATTATTATTTTGAATTTAATTTTTGATGGGTTTTGATTTGTATATTGGATAATTCATAATCACTAACTTTTTTATAGGAAAAAAAAA
BLAST of CU088656 vs. TrEMBL
Match: A0A0A0LSP4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G118870 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 3.4e-06 Identity = 24/24 (100.00%), Postives = 24/24 (100.00%), Query Frame = 3
BLAST of CU088656 vs. NCBI nr
Match: gi|700209722|gb|KGN64818.1| (hypothetical protein Csa_1G118870 [Cucumis sativus]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 24/24 (100.00%), Postives = 24/24 (100.00%), Query Frame = 3
BLAST of CU088656 vs. NCBI nr
Match: gi|449443572|ref|XP_004139551.1| (PREDICTED: uncharacterized protein LOC101221529 [Cucumis sativus]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 24/24 (100.00%), Postives = 24/24 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|