CU088346 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTCCTTCACTCCACTTATTTGTGATGTATTAGATTGAACACATTCTCGAGTCGATTTTCGACAGCTATGTGAAAAAATGGTCTTCCCATCATCATCTTCTTCCCCATACAATATCTGGATTTGATTCGATTAGTATAATTAAAAACTCAACGTTTCCTGCTTTTGCAGCATCGTGTAGTAGTCTTGTAGATAGTTTAATGAAGTTGTCATTTCGTGGGAAGTTTTTCTGAAAAGCCAGCCATAATTGTTTAACTAATTTACGAGCGAACTTCTTCATCATATCTTTTCTGTAGATTCCTTTGTAGCAATGATTATTGATGGACTTTTTCCAAAAGTTGAATCTCTTCCTGCCACCGATTGCTGATGATTT
BLAST of CU088346 vs. TrEMBL
Match: A0A0A0LWX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058110 PE=4 SV=1) HSP 1 Score: 185.7 bits (470), Expect = 3.5e-44 Identity = 88/89 (98.88%), Postives = 89/89 (100.00%), Query Frame = -1
BLAST of CU088346 vs. TrEMBL
Match: A0A0A0LWX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058110 PE=4 SV=1) HSP 1 Score: 44.7 bits (104), Expect = 9.6e-02 Identity = 19/22 (86.36%), Postives = 20/22 (90.91%), Query Frame = -3
HSP 2 Score: 29.6 bits (65), Expect = 3.2e+03 Identity = 18/34 (52.94%), Postives = 21/34 (61.76%), Query Frame = -2
HSP 3 Score: 85.1 bits (209), Expect = 6.4e-14 Identity = 46/91 (50.55%), Postives = 56/91 (61.54%), Query Frame = -1
BLAST of CU088346 vs. TrEMBL
Match: A0A0A0LU19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058090 PE=4 SV=1) HSP 1 Score: 38.9 bits (89), Expect = 5.3e+00 Identity = 17/21 (80.95%), Postives = 19/21 (90.48%), Query Frame = -3
HSP 2 Score: 75.9 bits (185), Expect = 3.9e-11 Identity = 41/91 (45.05%), Postives = 54/91 (59.34%), Query Frame = -1
BLAST of CU088346 vs. TrEMBL
Match: A0A0A0KRV4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G174620 PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 2.0e+01 Identity = 15/21 (71.43%), Postives = 19/21 (90.48%), Query Frame = -3
HSP 2 Score: 74.7 bits (182), Expect = 8.7e-11 Identity = 43/91 (47.25%), Postives = 52/91 (57.14%), Query Frame = -1
BLAST of CU088346 vs. TrEMBL
Match: A0A0A0LUM4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058120 PE=4 SV=1) HSP 1 Score: 39.3 bits (90), Expect = 4.1e+00 Identity = 17/20 (85.00%), Postives = 18/20 (90.00%), Query Frame = -3
HSP 2 Score: 70.9 bits (172), Expect = 1.3e-09 Identity = 36/90 (40.00%), Postives = 57/90 (63.33%), Query Frame = -1
BLAST of CU088346 vs. NCBI nr
Match: gi|778658316|ref|XP_011652495.1| (PREDICTED: ankyrin repeat-containing protein At3g12360 isoform X2 [Cucumis sativus]) HSP 1 Score: 186.0 bits (471), Expect = 3.8e-44 Identity = 88/89 (98.88%), Postives = 89/89 (100.00%), Query Frame = -1
BLAST of CU088346 vs. NCBI nr
Match: gi|449470726|ref|XP_004153067.1| (PREDICTED: ankyrin repeat-containing protein At3g12360 isoform X1 [Cucumis sativus]) HSP 1 Score: 186.0 bits (471), Expect = 3.8e-44 Identity = 88/89 (98.88%), Postives = 89/89 (100.00%), Query Frame = -1
BLAST of CU088346 vs. NCBI nr
Match: gi|659067665|ref|XP_008440652.1| (PREDICTED: ankyrin repeat-containing protein At3g12360-like [Cucumis melo]) HSP 1 Score: 169.1 bits (427), Expect = 4.9e-39 Identity = 78/89 (87.64%), Postives = 83/89 (93.26%), Query Frame = -1
BLAST of CU088346 vs. NCBI nr
Match: gi|449473453|ref|XP_004153885.1| (PREDICTED: ankyrin repeat-containing protein At5g02620-like [Cucumis sativus]) HSP 1 Score: 85.5 bits (210), Expect = 7.1e-14 Identity = 46/91 (50.55%), Postives = 56/91 (61.54%), Query Frame = -1
BLAST of CU088346 vs. NCBI nr
Match: gi|659067652|ref|XP_008440580.1| (PREDICTED: ankyrin repeat-containing protein At3g12360-like isoform X2 [Cucumis melo]) HSP 1 Score: 84.7 bits (208), Expect = 1.2e-13 Identity = 45/91 (49.45%), Postives = 56/91 (61.54%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|