CU088168 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGTTCCGATGCCGAAGACCATCCGTCTTGAGAACGATGGATTTAAGTGCCCTGCCCCTCGCCATCGCGGTAAGAGAACAATGCATGTATGCTGCAAAAGGATCCAAAGTTCAAGGTGAAAGAAAAGAAAAAAAGACCAAATTTTTCGCTCGACCAAAATGGAGACCTCTCACTCACTTACGATGTAATGCAAGCTTATGGAAATAATTATCTCGCTCAAGT
BLAST of CU088168 vs. TrEMBL
Match: A0A0A0L312_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G078790 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 1.0e-11 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = 2
BLAST of CU088168 vs. TrEMBL
Match: A0A0A0L312_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G078790 PE=4 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 1.4e-03 Identity = 23/29 (79.31%), Postives = 24/29 (82.76%), Query Frame = 1
HSP 2 Score: 58.9 bits (141), Expect = 2.9e-06 Identity = 24/32 (75.00%), Postives = 26/32 (81.25%), Query Frame = 2
BLAST of CU088168 vs. TrEMBL
Match: W9RRX7_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_011885 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 1.8e+00 Identity = 16/22 (72.73%), Postives = 19/22 (86.36%), Query Frame = 1
HSP 2 Score: 58.2 bits (139), Expect = 5.0e-06 Identity = 24/34 (70.59%), Postives = 28/34 (82.35%), Query Frame = 2
BLAST of CU088168 vs. TrEMBL
Match: A0A0A0L8A2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G423810 PE=4 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 5.2e-03 Identity = 21/22 (95.45%), Postives = 22/22 (100.00%), Query Frame = 1
BLAST of CU088168 vs. NCBI nr
Match: gi|449470463|ref|XP_004152936.1| (PREDICTED: COBRA-like protein 10 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 1.5e-11 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = 2
BLAST of CU088168 vs. NCBI nr
Match: gi|659126984|ref|XP_008463461.1| (PREDICTED: COBRA-like protein 10 [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 2.8e-10 Identity = 30/33 (90.91%), Postives = 32/33 (96.97%), Query Frame = 2
BLAST of CU088168 vs. NCBI nr
Match: gi|703134138|ref|XP_010105567.1| (hypothetical protein L484_011885 [Morus notabilis]) HSP 1 Score: 59.3 bits (142), Expect = 3.2e-06 Identity = 24/32 (75.00%), Postives = 26/32 (81.25%), Query Frame = 2
BLAST of CU088168 vs. NCBI nr
Match: gi|470119390|ref|XP_004295797.1| (PREDICTED: COBRA-like protein 10 [Fragaria vesca subsp. vesca]) HSP 1 Score: 58.9 bits (141), Expect = 4.2e-06 Identity = 25/31 (80.65%), Postives = 26/31 (83.87%), Query Frame = 2
BLAST of CU088168 vs. NCBI nr
Match: gi|778688637|ref|XP_011652799.1| (PREDICTED: COBRA-like protein 10 [Cucumis sativus]) HSP 1 Score: 58.2 bits (139), Expect = 7.2e-06 Identity = 24/34 (70.59%), Postives = 28/34 (82.35%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|