CU087776 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGATACTCCTTCTATGCCCATGATCCTCACTGCTGTTGGAATTGCTCTCTTCGCTAAACTCCTTATGATGTATGATGAGTCAAGATCTGAAGAGTTGATAGAGCGACAAAATAAAGAATGCTACCACCAGGTCAAGGAACTGTGAGGATGCTTAGTCGTCGGGAGTGGGAGGAAATTCGAGAAGTTCGACCAAGGACTCCGTTCGAATCCAAGCTTGCTCGTCCAAAATGCAAGAATCAGAACTGGAGAACC
BLAST of CU087776 vs. TrEMBL
Match: A0A0A0LR33_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000630 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.4e-11 Identity = 49/86 (56.98%), Postives = 57/86 (66.28%), Query Frame = 2
BLAST of CU087776 vs. TrEMBL
Match: A0A061F9Y0_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_032134 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.3e-10 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CU087776 vs. TrEMBL
Match: A0A061F9Y0_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_032134 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 8.8e-07 Identity = 38/86 (44.19%), Postives = 53/86 (61.63%), Query Frame = 2
HSP 2 Score: 72.8 bits (177), Expect = 2.3e-10 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of CU087776 vs. TrEMBL
Match: A0A0D2Q0T7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G046300 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.8e-05 Identity = 36/86 (41.86%), Postives = 51/86 (59.30%), Query Frame = 2
HSP 2 Score: 72.8 bits (177), Expect = 2.3e-10 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of CU087776 vs. TrEMBL
Match: A0A0D2NIA1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G046300 PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.8e-05 Identity = 36/86 (41.86%), Postives = 51/86 (59.30%), Query Frame = 2
HSP 2 Score: 72.8 bits (177), Expect = 2.3e-10 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of CU087776 vs. NCBI nr
Match: gi|449440500|ref|XP_004138022.1| (PREDICTED: uncharacterized protein LOC101207324 [Cucumis sativus]) HSP 1 Score: 77.4 bits (189), Expect = 1.3e-11 Identity = 49/86 (56.98%), Postives = 57/86 (66.28%), Query Frame = 2
BLAST of CU087776 vs. NCBI nr
Match: gi|659128795|ref|XP_008464374.1| (PREDICTED: uncharacterized protein LOC103502279 isoform X1 [Cucumis melo]) HSP 1 Score: 77.0 bits (188), Expect = 1.7e-11 Identity = 49/86 (56.98%), Postives = 56/86 (65.12%), Query Frame = 2
BLAST of CU087776 vs. NCBI nr
Match: gi|823130797|ref|XP_012454845.1| (PREDICTED: uncharacterized protein LOC105776623 isoform X1 [Gossypium raimondii]) HSP 1 Score: 72.8 bits (177), Expect = 3.2e-10 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of CU087776 vs. NCBI nr
Match: gi|823130803|ref|XP_012454872.1| (PREDICTED: uncharacterized protein LOC105776623 isoform X4 [Gossypium raimondii]) HSP 1 Score: 72.8 bits (177), Expect = 3.2e-10 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
BLAST of CU087776 vs. NCBI nr
Match: gi|590611105|ref|XP_007022007.1| (Uncharacterized protein TCM_032134 [Theobroma cacao]) HSP 1 Score: 72.8 bits (177), Expect = 3.2e-10 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|