CU087637 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGAACAACAGGGTGTTGTCCTGATAGCAAGTGGCCACAGATAAGCAGGAAGACACAGCTAGTGATGGATGCGGTGAAAAAATCCATTGATATTGATTGTAAGACCAGTGTATTTGTAATTTTCTTTTTGACAAAGAACAAGCTTTTCGTATAAACAGCATTGCCATACCTGAGGCTTGATTGTAGACCAATTTAGCCTCTACATAAACTAAGGTAATAAAAGACAGGTTTTTGGGTGGAAAAAAAAAG
BLAST of CU087637 vs. TrEMBL
Match: A0A0A0LA36_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G194390 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.4e-11 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU087637 vs. NCBI nr
Match: gi|449445937|ref|XP_004140728.1| (PREDICTED: uncharacterized oxidoreductase At4g09670-like [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 4.9e-11 Identity = 33/34 (97.06%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU087637 vs. NCBI nr
Match: gi|659112395|ref|XP_008456198.1| (PREDICTED: uncharacterized oxidoreductase At4g09670-like [Cucumis melo]) HSP 1 Score: 73.6 bits (179), Expect = 1.9e-10 Identity = 32/34 (94.12%), Postives = 33/34 (97.06%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|