CU087193 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATAGAGAACAGTTTTTTGCCAGGGGGATTATTTGAGAATGAATTCGATATCGTGTTCACGGTAGGGCAGATCGGAGCCCGATTTGTTGACCGTGTTCTTAGAAGCGGCGGGGCGGTGGTTCTTCCGGCGACGGATATTTCTGATCGTGTTCAGTTCATGAAAAGAAAGGAATCTTCTCTACTCTGAGCTTCGGTCCATGAAATCCAGCAACCACGGTTCTTCGAATCCAAATGATACCTGAACTGCGTACGAATTAAAAACTAGG
BLAST of CU087193 vs. TrEMBL
Match: A0A0A0KJZ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G427990 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 3.4e-17 Identity = 48/50 (96.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of CU087193 vs. TrEMBL
Match: A0A0A0KGY9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G428020 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 7.1e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -2
BLAST of CU087193 vs. NCBI nr
Match: gi|778722330|ref|XP_011658464.1| (PREDICTED: uncharacterized protein LOC105436015 [Cucumis sativus]) HSP 1 Score: 97.1 bits (240), Expect = 1.7e-17 Identity = 48/50 (96.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of CU087193 vs. NCBI nr
Match: gi|700192865|gb|KGN48069.1| (hypothetical protein Csa_6G428020 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 6.0e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|