CU086979 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTTAAGTAGTTTTTTGTAATTAAATTAATAAAAACTAACAATGATTATTGATGGACTTTTTCCAAAAGTTGAATCTCTTCCTGCCACCGATTGCTGATGATTTTCTGGCTAGCACAAGCAATGCAAGCTCATTGTTGTTATTTTCGTCTTCCACAATTGCTAACTTCTCATTTTTTTCAAAAATCTTCATACTCATGTCATAGAAGTTGCTATGTATGGAGGCA
BLAST of CU086979 vs. TrEMBL
Match: A0A0A0LWX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G058110 PE=4 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.5e-18 Identity = 49/62 (79.03%), Postives = 49/62 (79.03%), Query Frame = -2
BLAST of CU086979 vs. NCBI nr
Match: gi|778658316|ref|XP_011652495.1| (PREDICTED: ankyrin repeat-containing protein At3g12360 isoform X2 [Cucumis sativus]) HSP 1 Score: 100.9 bits (250), Expect = 9.8e-19 Identity = 49/62 (79.03%), Postives = 49/62 (79.03%), Query Frame = -2
BLAST of CU086979 vs. NCBI nr
Match: gi|449470726|ref|XP_004153067.1| (PREDICTED: ankyrin repeat-containing protein At3g12360 isoform X1 [Cucumis sativus]) HSP 1 Score: 100.9 bits (250), Expect = 9.8e-19 Identity = 49/62 (79.03%), Postives = 49/62 (79.03%), Query Frame = -2
BLAST of CU086979 vs. NCBI nr
Match: gi|659067665|ref|XP_008440652.1| (PREDICTED: ankyrin repeat-containing protein At3g12360-like [Cucumis melo]) HSP 1 Score: 84.7 bits (208), Expect = 7.3e-14 Identity = 40/62 (64.52%), Postives = 43/62 (69.35%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|