CU086846 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGAATTACTAGACCCAAGATTGAAATTGACTCCAGCATTATTTATCAGAATATCCAAACCACCATAGTTTTGCAGCAGCCAAGTCAGCAAATTGTTTGATGGATAAAGCATCCAAGACATCCAATTGATGAAAGGCAACATTCAGGCCACCTTCCTGTAAAACTTTTAGCTGCTTCAAGGCCAACACAAACATCTCTTGAAGTCAAGATCACGGTCATTCCATGCATTGCAATTGCCTTGAAATCTTCAAATCCAAGTTCCTCTCCC
BLAST of CU086846 vs. TrEMBL
Match: A0A0A0LNP6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000030 PE=3 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.1e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -1
BLAST of CU086846 vs. TrEMBL
Match: A0A0A0LNP6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000030 PE=3 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.7e-06 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = -3
HSP 2 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 25/31 (80.65%), Postives = 27/31 (87.10%), Query Frame = -2
HSP 3 Score: 59.3 bits (142), Expect = 2.7e-06 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = -3
BLAST of CU086846 vs. TrEMBL
Match: E5GBL1_CUCME (Short-chain dehydrogenase/reductase family protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-04 Identity = 25/31 (80.65%), Postives = 27/31 (87.10%), Query Frame = -2
HSP 2 Score: 48.9 bits (115), Expect = 3.7e-03 Identity = 27/44 (61.36%), Postives = 27/44 (61.36%), Query Frame = -1
HSP 3 Score: 58.2 bits (139), Expect = 6.1e-06 Identity = 25/32 (78.12%), Postives = 28/32 (87.50%), Query Frame = -1
BLAST of CU086846 vs. TrEMBL
Match: G7I950_MEDTR (Short chain dehydrogenase/reductase OS=Medicago truncatula GN=MTR_1g031180 PE=3 SV=1) HSP 1 Score: 38.1 bits (87), Expect = 6.5e+00 Identity = 17/31 (54.84%), Postives = 22/31 (70.97%), Query Frame = -2
HSP 2 Score: 37.0 bits (84), Expect = 1.4e+01 Identity = 14/31 (45.16%), Postives = 23/31 (74.19%), Query Frame = -3
BLAST of CU086846 vs. NCBI nr
Match: gi|659128763|ref|XP_008464357.1| (PREDICTED: LOW QUALITY PROTEIN: carbonyl reductase [NADPH]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = -3
BLAST of CU086846 vs. NCBI nr
Match: gi|449440486|ref|XP_004138015.1| (PREDICTED: (+)-neomenthol dehydrogenase-like [Cucumis sativus]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = -3
BLAST of CU086846 vs. NCBI nr
Match: gi|307136013|gb|ADN33869.1| (short-chain dehydrogenase/reductase family protein [Cucumis melo subsp. melo]) HSP 1 Score: 60.5 bits (145), Expect = 1.7e-06 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|