CU084678 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGACCGGAAGGATGTGACAGAGACCATCCGTCGGTAAACGTTTTCGGTCCAAACGCGACGGATATATCGAATGTAAGGTATCCGGCGACTAAAGTGTTGGTTGGAGGATTAGATCCGTTAATCGATTGGCAAAAGAGATACTACGAAGGATTGAAGAAATCCGGGAAGGAAGCTTACTTGAGTGAATATCCGAATGCGTTTCACAGCTTTTAACGGAATTTCCGGAGTTGGCGGAATCCAATCTGTTCATCAAAGATGTTAGGGATTTCGTAGGGGAACAATGCTTGAAGAGAAGCAGTTGAAGGAATCAGAATCACGAATTCAGCGGATGATGGTCAAGGAACGGTAAGATTTAAAAGCTTTGTGCGTTTTATTTGATTACAAATTAAGAACAAATATTAAGATAGTGTATGAAAATGATGGTTGAAGACATGTGACTCATTAATAAGTACTTCTACTTGTATTAAATATTTTCTAACTTACTCCC
BLAST of CU084678 vs. Swiss-Prot
Match: CXE18_ARATH (Probable carboxylesterase 18 OS=Arabidopsis thaliana GN=CXE18 PE=1 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 1.1e-17 Identity = 42/67 (62.69%), Postives = 47/67 (70.15%), Query Frame = 1
BLAST of CU084678 vs. Swiss-Prot
Match: GID1B_ARATH (Gibberellin receptor GID1B OS=Arabidopsis thaliana GN=GID1B PE=1 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 2.8e-10 Identity = 30/59 (50.85%), Postives = 36/59 (61.02%), Query Frame = 1
BLAST of CU084678 vs. Swiss-Prot
Match: GID1A_ARATH (Gibberellin receptor GID1A OS=Arabidopsis thaliana GN=GID1A PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 6.3e-10 Identity = 31/69 (44.93%), Postives = 38/69 (55.07%), Query Frame = 1
BLAST of CU084678 vs. Swiss-Prot
Match: GID1C_ARATH (Gibberellin receptor GID1C OS=Arabidopsis thaliana GN=GID1C PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 6.3e-10 Identity = 28/59 (47.46%), Postives = 39/59 (66.10%), Query Frame = 1
BLAST of CU084678 vs. TrEMBL
Match: A0A0A0KII8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G361280 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 1.3e-33 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CU084678 vs. TrEMBL
Match: V4TNL0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10024355mg PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 5.4e-24 Identity = 51/69 (73.91%), Postives = 58/69 (84.06%), Query Frame = 1
BLAST of CU084678 vs. TrEMBL
Match: A0A067DHU8_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g038541mg PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.7e-23 Identity = 52/69 (75.36%), Postives = 60/69 (86.96%), Query Frame = 1
BLAST of CU084678 vs. TrEMBL
Match: V4TNL6_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10024259mg PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 1.0e-22 Identity = 52/69 (75.36%), Postives = 58/69 (84.06%), Query Frame = 1
BLAST of CU084678 vs. TrEMBL
Match: A0A067K634_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_14822 PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 1.7e-22 Identity = 50/69 (72.46%), Postives = 59/69 (85.51%), Query Frame = 1
BLAST of CU084678 vs. NCBI nr
Match: gi|700192362|gb|KGN47566.1| (hypothetical protein Csa_6G361280 [Cucumis sativus]) HSP 1 Score: 151.8 bits (382), Expect = 1.1e-33 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CU084678 vs. NCBI nr
Match: gi|778715188|ref|XP_004144282.2| (PREDICTED: probable carboxylesterase 18 [Cucumis sativus]) HSP 1 Score: 151.8 bits (382), Expect = 1.1e-33 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CU084678 vs. NCBI nr
Match: gi|659129863|ref|XP_008464884.1| (PREDICTED: probable carboxylesterase 18 [Cucumis melo]) HSP 1 Score: 147.5 bits (371), Expect = 2.0e-32 Identity = 66/69 (95.65%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CU084678 vs. NCBI nr
Match: gi|567898568|ref|XP_006441772.1| (hypothetical protein CICLE_v10024355mg [Citrus clementina]) HSP 1 Score: 119.8 bits (299), Expect = 4.5e-24 Identity = 51/69 (73.91%), Postives = 58/69 (84.06%), Query Frame = 1
BLAST of CU084678 vs. NCBI nr
Match: gi|641822993|gb|KDO42448.1| (hypothetical protein CISIN_1g038541mg, partial [Citrus sinensis]) HSP 1 Score: 117.5 bits (293), Expect = 2.2e-23 Identity = 52/69 (75.36%), Postives = 60/69 (86.96%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|