CU084587 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACAAACGCTCTTCTTCGTTCCATTTCACCATTGTCATAACTGTTAGCGTTCCTCCGTCTCCATTAAAGCCCACGCAGACTGCTCCAATCAATCTTCTTTGCATAATATTATGTTACAGATACTCTCCTAGCGCACCGCAAAAACCTACCCATCTCTCTTCGCGAATCCAGATCGTGGCAAGACTCGACACTGAGCAGCCTGAAAATGAGTGACAGCCAGAAGTT
BLAST of CU084587 vs. TrEMBL
Match: A0A0A0LSE9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025990 PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 1.1e-22 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = 3
BLAST of CU084587 vs. TrEMBL
Match: A0A0A0LSE9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025990 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 8.7e-01 Identity = 19/19 (100.00%), Postives = 19/19 (100.00%), Query Frame = 1
BLAST of CU084587 vs. NCBI nr
Match: gi|700208823|gb|KGN63919.1| (hypothetical protein Csa_1G025990 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 2.0e-22 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|