CU084454 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGATCCAACAAATACTCAATTTCCTAAATTAAATTGCATATCAAGCAGAACACCATTCAAACTCACTCACCCTTCTCTTGTTTAGAATAAATATTTGACATGGGAATTCGTTTGCCATCTATTCTTCTTAATGCCAAGCAGGTCCTGAAAATGCAAGCTATGTCTGCCAGAAATCAATCTGATGTTCCCAAAGGCCATATTGCAGTTTACGTGGGAGAGATTCAAAGGAAGAGATTTGTCGTCCCTATATCATACTTGAAGCATCCTTCTTTTGTAGATCTGCTCAATAGA
BLAST of CU084454 vs. Swiss-Prot
Match: SAU20_ARATH (Auxin-responsive protein SAUR20 OS=Arabidopsis thaliana GN=SAUR20 PE=2 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 8.0e-08 Identity = 30/56 (53.57%), Postives = 37/56 (66.07%), Query Frame = 2
BLAST of CU084454 vs. Swiss-Prot
Match: AXX15_SOYBN (Auxin-induced protein X15 OS=Glycine max PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.8e-07 Identity = 31/64 (48.44%), Postives = 36/64 (56.25%), Query Frame = 2
BLAST of CU084454 vs. Swiss-Prot
Match: SAU21_ARATH (Auxin-responsive protein SAUR21 OS=Arabidopsis thaliana GN=SAUR21 PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.8e-07 Identity = 29/56 (51.79%), Postives = 36/56 (64.29%), Query Frame = 2
BLAST of CU084454 vs. Swiss-Prot
Match: AX15A_SOYBN (Auxin-induced protein 15A OS=Glycine max PE=2 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 2.3e-07 Identity = 31/64 (48.44%), Postives = 37/64 (57.81%), Query Frame = 2
BLAST of CU084454 vs. Swiss-Prot
Match: ARG7_VIGRR (Indole-3-acetic acid-induced protein ARG7 OS=Vigna radiata var. radiata GN=ARG7 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 4.0e-07 Identity = 32/69 (46.38%), Postives = 41/69 (59.42%), Query Frame = 2
BLAST of CU084454 vs. TrEMBL
Match: A0A0A0LM74_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258830 PE=4 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.9e-25 Identity = 61/64 (95.31%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of CU084454 vs. TrEMBL
Match: A0A0A0LPJ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258820 PE=4 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 5.0e-25 Identity = 61/64 (95.31%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of CU084454 vs. TrEMBL
Match: A0A061DYL9_THECC (SAUR-like auxin-responsive protein family OS=Theobroma cacao GN=TCM_006722 PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 3.7e-20 Identity = 54/87 (62.07%), Postives = 71/87 (81.61%), Query Frame = 2
BLAST of CU084454 vs. TrEMBL
Match: A0A0A0LM65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258730 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 50/64 (78.12%), Postives = 58/64 (90.62%), Query Frame = 2
BLAST of CU084454 vs. TrEMBL
Match: F6GX22_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_04s0023g00560 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.4e-19 Identity = 48/64 (75.00%), Postives = 57/64 (89.06%), Query Frame = 2
BLAST of CU084454 vs. NCBI nr
Match: gi|778669614|ref|XP_011649278.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 5.9e-27 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 2
BLAST of CU084454 vs. NCBI nr
Match: gi|659115604|ref|XP_008457639.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 124.0 bits (310), Expect = 1.4e-25 Identity = 62/64 (96.88%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of CU084454 vs. NCBI nr
Match: gi|778669611|ref|XP_011649277.1| (PREDICTED: auxin-induced protein X15-like [Cucumis sativus]) HSP 1 Score: 123.2 bits (308), Expect = 2.5e-25 Identity = 61/64 (95.31%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of CU084454 vs. NCBI nr
Match: gi|700206767|gb|KGN61886.1| (hypothetical protein Csa_2G258820 [Cucumis sativus]) HSP 1 Score: 122.5 bits (306), Expect = 4.2e-25 Identity = 61/64 (95.31%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of CU084454 vs. NCBI nr
Match: gi|590684890|ref|XP_007041959.1| (SAUR-like auxin-responsive protein family [Theobroma cacao]) HSP 1 Score: 108.2 bits (269), Expect = 8.2e-21 Identity = 54/87 (62.07%), Postives = 71/87 (81.61%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|