CmoCh20G008070.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCATCCAAAAGCTTAACAAACTCCCCCAATCCACCGTCCTCAAGCAAATCCTCAAACGTTGCTCGAGCCTCGGTCGAAAGACCAACAACGCCTGTGCCTACGACGCCGACGACGACCTCCCCCTCGACGTCCCCAAGGGTCATTTCGCTGTCTACGTCGGCGAAAATCGTAGCCGATTCATCGTCCCTATCTCCGTCCTTACTCACCCTGAATTCCAATGCTTACTCCGTCAAGCAGAAGAAGAATTCGGATTCGACCACTACATGGGTCTCACCATCCCTTGCCAAGAACACGTCTTCAGATCCTTAACATCCTCCATGCTTCGATGA ATGGCCATCCAAAAGCTTAACAAACTCCCCCAATCCACCGTCCTCAAGCAAATCCTCAAACGTTGCTCGAGCCTCGGTCGAAAGACCAACAACGCCTGTGCCTACGACGCCGACGACGACCTCCCCCTCGACGTCCCCAAGGGTCATTTCGCTGTCTACGTCGGCGAAAATCGTAGCCGATTCATCGTCCCTATCTCCGTCCTTACTCACCCTGAATTCCAATGCTTACTCCGTCAAGCAGAAGAAGAATTCGGATTCGACCACTACATGGGTCTCACCATCCCTTGCCAAGAACACGTCTTCAGATCCTTAACATCCTCCATGCTTCGATGA ATGGCCATCCAAAAGCTTAACAAACTCCCCCAATCCACCGTCCTCAAGCAAATCCTCAAACGTTGCTCGAGCCTCGGTCGAAAGACCAACAACGCCTGTGCCTACGACGCCGACGACGACCTCCCCCTCGACGTCCCCAAGGGTCATTTCGCTGTCTACGTCGGCGAAAATCGTAGCCGATTCATCGTCCCTATCTCCGTCCTTACTCACCCTGAATTCCAATGCTTACTCCGTCAAGCAGAAGAAGAATTCGGATTCGACCACTACATGGGTCTCACCATCCCTTGCCAAGAACACGTCTTCAGATCCTTAACATCCTCCATGCTTCGATGA
BLAST of CmoCh20G008070.1 vs. Swiss-Prot
Match: ARG7_VIGRR (Indole-3-acetic acid-induced protein ARG7 OS=Vigna radiata var. radiata GN=ARG7 PE=2 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 5.5e-18 Identity = 42/67 (62.69%), Postives = 51/67 (76.12%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. Swiss-Prot
Match: AX15A_SOYBN (Auxin-induced protein 15A OS=Glycine max PE=2 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.2e-17 Identity = 41/66 (62.12%), Postives = 49/66 (74.24%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. Swiss-Prot
Match: AXX15_SOYBN (Auxin-induced protein X15 OS=Glycine max PE=2 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 3.6e-17 Identity = 39/64 (60.94%), Postives = 48/64 (75.00%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. Swiss-Prot
Match: AX10A_SOYBN (Auxin-induced protein X10A OS=Glycine max PE=2 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 4.0e-16 Identity = 38/67 (56.72%), Postives = 50/67 (74.63%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. Swiss-Prot
Match: A10A5_SOYBN (Auxin-induced protein 10A5 OS=Glycine max PE=2 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 5.2e-16 Identity = 39/67 (58.21%), Postives = 50/67 (74.63%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TrEMBL
Match: A0A0A0LJ77_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258100 PE=4 SV=1) HSP 1 Score: 206.5 bits (524), Expect = 1.7e-50 Identity = 101/110 (91.82%), Postives = 105/110 (95.45%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TrEMBL
Match: W9QZT5_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_012234 PE=4 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.7e-40 Identity = 89/110 (80.91%), Postives = 97/110 (88.18%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TrEMBL
Match: K4B3S0_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 171.8 bits (434), Expect = 4.7e-40 Identity = 84/110 (76.36%), Postives = 97/110 (88.18%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TrEMBL
Match: M0ZN14_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400001668 PE=4 SV=1) HSP 1 Score: 170.6 bits (431), Expect = 1.0e-39 Identity = 83/110 (75.45%), Postives = 97/110 (88.18%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TrEMBL
Match: A0A067JXT7_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_19628 PE=4 SV=1) HSP 1 Score: 169.9 bits (429), Expect = 1.8e-39 Identity = 87/108 (80.56%), Postives = 94/108 (87.04%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TAIR10
Match: AT1G75580.1 (AT1G75580.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 152.5 bits (384), Expect = 1.5e-37 Identity = 77/110 (70.00%), Postives = 91/110 (82.73%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TAIR10
Match: AT4G34760.1 (AT4G34760.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 151.4 bits (381), Expect = 3.3e-37 Identity = 76/104 (73.08%), Postives = 88/104 (84.62%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TAIR10
Match: AT2G21220.1 (AT2G21220.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 146.4 bits (368), Expect = 1.1e-35 Identity = 74/106 (69.81%), Postives = 89/106 (83.96%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TAIR10
Match: AT1G19830.1 (AT1G19830.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 146.0 bits (367), Expect = 1.4e-35 Identity = 74/114 (64.91%), Postives = 89/114 (78.07%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. TAIR10
Match: AT2G16580.1 (AT2G16580.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 142.1 bits (357), Expect = 2.0e-34 Identity = 71/104 (68.27%), Postives = 84/104 (80.77%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. NCBI nr
Match: gi|449458540|ref|XP_004147005.1| (PREDICTED: auxin-induced protein 15A [Cucumis sativus]) HSP 1 Score: 206.5 bits (524), Expect = 2.5e-50 Identity = 101/110 (91.82%), Postives = 105/110 (95.45%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. NCBI nr
Match: gi|700206744|gb|KGN61863.1| (hypothetical protein Csa_2G258100 [Cucumis sativus]) HSP 1 Score: 206.5 bits (524), Expect = 2.5e-50 Identity = 101/110 (91.82%), Postives = 105/110 (95.45%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. NCBI nr
Match: gi|659115572|ref|XP_008457621.1| (PREDICTED: auxin-induced protein 15A [Cucumis melo]) HSP 1 Score: 205.3 bits (521), Expect = 5.5e-50 Identity = 99/110 (90.00%), Postives = 105/110 (95.45%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. NCBI nr
Match: gi|703095897|ref|XP_010095663.1| (hypothetical protein L484_012234 [Morus notabilis]) HSP 1 Score: 172.6 bits (436), Expect = 3.9e-40 Identity = 89/110 (80.91%), Postives = 97/110 (88.18%), Query Frame = 1
BLAST of CmoCh20G008070.1 vs. NCBI nr
Match: gi|460370303|ref|XP_004230993.1| (PREDICTED: auxin-induced protein 15A-like [Solanum lycopersicum]) HSP 1 Score: 171.8 bits (434), Expect = 6.7e-40 Identity = 84/110 (76.36%), Postives = 97/110 (88.18%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|