CSPI04G22560.1 (mRNA) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGGAGAAAGATAGTTTAATGGAGCTAGTTGATCCAAAGTTGGGCTTAAACTTCAACGAGGAAGAGGCAATGAAAATGATGAATATTGCTTTTCTTTTCCCCAATGTGTCTCCCTCGACCATACCTACAATGTCCTTTGTGGTGGGCATGCTGGAAGGTAAGGTTGTTGTCAAGGAGTTAGTTTCAGATTCTGATGACATGAGAAAGGAGATGAGGGCAATGTGGACTCTTATTCAGCAGAATGAAACGGTAATCGAGGACGAGAATGAGAATGAAACTGAGAGCCTATCATTCGTAAACATGCGATCAACCAGTTCTTCGACATCAATGAAGAACAAAAACTAG ATGAAGGAGAAAGATAGTTTAATGGAGCTAGTTGATCCAAAGTTGGGCTTAAACTTCAACGAGGAAGAGGCAATGAAAATGATGAATATTGCTTTTCTTTTCCCCAATGTGTCTCCCTCGACCATACCTACAATGTCCTTTGTGGTGGGCATGCTGGAAGGTAAGGTTGTTGTCAAGGAGTTAGTTTCAGATTCTGATGACATGAGAAAGGAGATGAGGGCAATGTGGACTCTTATTCAGCAGAATGAAACGGTAATCGAGGACGAGAATGAGAATGAAACTGAGAGCCTATCATTCGTAAACATGCGATCAACCAGTTCTTCGACATCAATGAAGAACAAAAACTAG ATGAAGGAGAAAGATAGTTTAATGGAGCTAGTTGATCCAAAGTTGGGCTTAAACTTCAACGAGGAAGAGGCAATGAAAATGATGAATATTGCTTTTCTTTTCCCCAATGTGTCTCCCTCGACCATACCTACAATGTCCTTTGTGGTGGGCATGCTGGAAGGTAAGGTTGTTGTCAAGGAGTTAGTTTCAGATTCTGATGACATGAGAAAGGAGATGAGGGCAATGTGGACTCTTATTCAGCAGAATGAAACGGTAATCGAGGACGAGAATGAGAATGAAACTGAGAGCCTATCATTCGTAAACATGCGATCAACCAGTTCTTCGACATCAATGAAGAACAAAAACTAG
BLAST of CSPI04G22560.1 vs. Swiss-Prot
Match: Y1765_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At1g07650 OS=Arabidopsis thaliana GN=At1g07650 PE=1 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 3.1e-11 Identity = 37/85 (43.53%), Postives = 58/85 (68.24%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. Swiss-Prot
Match: Y5343_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At1g53430 OS=Arabidopsis thaliana GN=At1g53430 PE=1 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 9.0e-11 Identity = 42/107 (39.25%), Postives = 63/107 (58.88%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. Swiss-Prot
Match: Y5344_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At1g53440 OS=Arabidopsis thaliana GN=At1g53440 PE=2 SV=2) HSP 1 Score: 61.6 bits (148), Expect = 6.5e-09 Identity = 46/121 (38.02%), Postives = 70/121 (57.85%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. Swiss-Prot
Match: Y3148_ARATH (Probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 OS=Arabidopsis thaliana GN=LRR-RLK PE=2 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 5.5e-08 Identity = 42/117 (35.90%), Postives = 72/117 (61.54%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. Swiss-Prot
Match: Y1534_ARATH (Probable LRR receptor-like serine/threonine-protein kinase At1g53420 OS=Arabidopsis thaliana GN=At1g53420 PE=2 SV=2) HSP 1 Score: 55.1 bits (131), Expect = 6.0e-07 Identity = 37/108 (34.26%), Postives = 60/108 (55.56%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TrEMBL
Match: A0A0A0KZG5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G624410 PE=4 SV=1) HSP 1 Score: 214.5 bits (545), Expect = 6.6e-53 Identity = 114/115 (99.13%), Postives = 114/115 (99.13%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TrEMBL
Match: F6HBW9_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0018g00930 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 6.1e-14 Identity = 47/86 (54.65%), Postives = 64/86 (74.42%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TrEMBL
Match: A0A127AVY2_VERFO (LRR-RLK OS=Vernicia fordii PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.8e-11 Identity = 49/113 (43.36%), Postives = 70/113 (61.95%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TrEMBL
Match: A0A140G4W2_9ROSI (LRR-RLK OS=Vernicia montana PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.8e-11 Identity = 49/113 (43.36%), Postives = 70/113 (61.95%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TrEMBL
Match: A0A140G4W8_9ROSI (LRR-RLK OS=Vernicia montana PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.8e-11 Identity = 49/113 (43.36%), Postives = 70/113 (61.95%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TAIR10
Match: AT1G07650.2 (AT1G07650.2 Leucine-rich repeat transmembrane protein kinase) HSP 1 Score: 69.3 bits (168), Expect = 1.7e-12 Identity = 37/85 (43.53%), Postives = 58/85 (68.24%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TAIR10
Match: AT1G53430.1 (AT1G53430.1 Leucine-rich repeat transmembrane protein kinase) HSP 1 Score: 67.8 bits (164), Expect = 5.1e-12 Identity = 42/107 (39.25%), Postives = 63/107 (58.88%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TAIR10
Match: AT1G53440.1 (AT1G53440.1 Leucine-rich repeat transmembrane protein kinase) HSP 1 Score: 61.6 bits (148), Expect = 3.6e-10 Identity = 46/121 (38.02%), Postives = 70/121 (57.85%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TAIR10
Match: AT3G14840.2 (AT3G14840.2 Leucine-rich repeat transmembrane protein kinase) HSP 1 Score: 58.5 bits (140), Expect = 3.1e-09 Identity = 42/117 (35.90%), Postives = 72/117 (61.54%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. TAIR10
Match: AT1G53420.1 (AT1G53420.1 Leucine-rich repeat transmembrane protein kinase) HSP 1 Score: 55.1 bits (131), Expect = 3.4e-08 Identity = 37/108 (34.26%), Postives = 60/108 (55.56%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. NCBI nr
Match: gi|449456687|ref|XP_004146080.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g07650 [Cucumis sativus]) HSP 1 Score: 214.5 bits (545), Expect = 9.5e-53 Identity = 114/115 (99.13%), Postives = 114/115 (99.13%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. NCBI nr
Match: gi|700199877|gb|KGN55035.1| (hypothetical protein Csa_4G624410 [Cucumis sativus]) HSP 1 Score: 214.5 bits (545), Expect = 9.5e-53 Identity = 114/115 (99.13%), Postives = 114/115 (99.13%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. NCBI nr
Match: gi|659127640|ref|XP_008463810.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g07650 [Cucumis melo]) HSP 1 Score: 155.2 bits (391), Expect = 6.9e-35 Identity = 85/108 (78.70%), Postives = 93/108 (86.11%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. NCBI nr
Match: gi|298204715|emb|CBI25213.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 85.1 bits (209), Expect = 8.7e-14 Identity = 47/86 (54.65%), Postives = 64/86 (74.42%), Query Frame = 1
BLAST of CSPI04G22560.1 vs. NCBI nr
Match: gi|659127571|ref|XP_008463771.1| (PREDICTED: probable leucine-rich repeat receptor-like serine/threonine-protein kinase At3g14840 [Cucumis melo]) HSP 1 Score: 84.7 bits (208), Expect = 1.1e-13 Identity = 51/110 (46.36%), Postives = 75/110 (68.18%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
|