CSPI03G39380.1 (mRNA) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACTCAAGGTTACAGGGTTTTCATTGCCATTGCTATGATACTTGGTGATGGTCTTTACCATGTATTCTTCATGCCTTTTCAAACATTCTACAGCTTAGCTAAGCAGAAGTTCAGCAATGAAAAATTGAAAATGTTGATTCATCATTCGAAGTTACTGACTACGATGCTCAACGGGGAACTGATTAACTTCTTGAAAGATCAAATACCTAAATGGGTGGCAATGGTTGGCTATGTTGTACTTGCAGCCATACCTGTAATCACAGTTCCTTTAATCTTCCATAAGTTGAAATGGTACGGTATTTTGGCTCAC ATGACTCAAGGTTACAGGGTTTTCATTGCCATTGCTATGATACTTGGTGATGGTCTTTACCATGTATTCTTCATGCCTTTTCAAACATTCTACAGCTTAGCTAAGCAGAAGTTCAGCAATGAAAAATTGAAAATGTTGATTCATCATTCGAAGTTACTGACTACGATGCTCAACGGGGAACTGATTAACTTCTTGAAAGATCAAATACCTAAATGGGTGGCAATGGTTGGCTATGTTGTACTTGCAGCCATACCTGTAATCACAGTTCCTTTAATCTTCCATAAGTTGAAATGGTACGGTATTTTGGCTCAC ATGACTCAAGGTTACAGGGTTTTCATTGCCATTGCTATGATACTTGGTGATGGTCTTTACCATGTATTCTTCATGCCTTTTCAAACATTCTACAGCTTAGCTAAGCAGAAGTTCAGCAATGAAAAATTGAAAATGTTGATTCATCATTCGAAGTTACTGACTACGATGCTCAACGGGGAACTGATTAACTTCTTGAAAGATCAAATACCTAAATGGGTGGCAATGGTTGGCTATGTTGTACTTGCAGCCATACCTGTAATCACAGTTCCTTTAATCTTCCATAAGTTGAAATGGTACGGTATTTTGGCTCAC
BLAST of CSPI03G39380.1 vs. Swiss-Prot
Match: YSL7_ARATH (Probable metal-nicotianamine transporter YSL7 OS=Arabidopsis thaliana GN=YSL7 PE=2 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.6e-17 Identity = 53/103 (51.46%), Postives = 67/103 (65.05%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. Swiss-Prot
Match: YSL13_ORYSJ (Probable metal-nicotianamine transporter YSL13 OS=Oryza sativa subsp. japonica GN=YSL13 PE=2 SV=2) HSP 1 Score: 73.6 bits (179), Expect = 1.5e-12 Identity = 50/106 (47.17%), Postives = 63/106 (59.43%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. Swiss-Prot
Match: YSL12_ORYSJ (Probable metal-nicotianamine transporter YSL12 OS=Oryza sativa subsp. japonica GN=YSL12 PE=2 SV=2) HSP 1 Score: 71.2 bits (173), Expect = 7.3e-12 Identity = 48/109 (44.04%), Postives = 63/109 (57.80%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. Swiss-Prot
Match: YSL6_ORYSJ (Probable metal-nicotianamine transporter YSL6 OS=Oryza sativa subsp. japonica GN=YSL6 PE=2 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 9.5e-12 Identity = 43/103 (41.75%), Postives = 65/103 (63.11%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. Swiss-Prot
Match: YSL5_ORYSJ (Probable metal-nicotianamine transporter YSL5 OS=Oryza sativa subsp. japonica GN=YSL5 PE=2 SV=3) HSP 1 Score: 70.1 bits (170), Expect = 1.6e-11 Identity = 43/103 (41.75%), Postives = 64/103 (62.14%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TrEMBL
Match: A0A0A0LCV1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G828970 PE=4 SV=1) HSP 1 Score: 208.0 bits (528), Expect = 5.6e-51 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TrEMBL
Match: A0A0A0LCX3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G654470 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.4e-22 Identity = 60/100 (60.00%), Postives = 73/100 (73.00%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TrEMBL
Match: B9T1I2_RICCO (Oligopeptide transporter, putative OS=Ricinus communis GN=RCOM_0786860 PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 8.1e-18 Identity = 57/112 (50.89%), Postives = 69/112 (61.61%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TrEMBL
Match: A0A061E3I9_THECC (YELLOW STRIPE like 7 OS=Theobroma cacao GN=TCM_007749 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 6.9e-17 Identity = 55/104 (52.88%), Postives = 67/104 (64.42%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TrEMBL
Match: V4TGS4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10030879mg PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 7.6e-16 Identity = 51/102 (50.00%), Postives = 67/102 (65.69%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TAIR10
Match: AT1G65730.1 (AT1G65730.1 YELLOW STRIPE like 7) HSP 1 Score: 89.4 bits (220), Expect = 1.5e-18 Identity = 53/103 (51.46%), Postives = 67/103 (65.05%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TAIR10
Match: AT4G24120.1 (AT4G24120.1 YELLOW STRIPE like 1) HSP 1 Score: 68.9 bits (167), Expect = 2.0e-12 Identity = 38/99 (38.38%), Postives = 59/99 (59.60%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TAIR10
Match: AT5G24380.1 (AT5G24380.1 YELLOW STRIPE like 2) HSP 1 Score: 67.4 bits (163), Expect = 5.9e-12 Identity = 39/102 (38.24%), Postives = 61/102 (59.80%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TAIR10
Match: AT5G53550.1 (AT5G53550.1 YELLOW STRIPE like 3) HSP 1 Score: 64.7 bits (156), Expect = 3.9e-11 Identity = 37/99 (37.37%), Postives = 58/99 (58.59%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. TAIR10
Match: AT3G27020.1 (AT3G27020.1 YELLOW STRIPE like 6) HSP 1 Score: 63.2 bits (152), Expect = 1.1e-10 Identity = 43/105 (40.95%), Postives = 60/105 (57.14%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. NCBI nr
Match: gi|700204475|gb|KGN59608.1| (hypothetical protein Csa_3G828970 [Cucumis sativus]) HSP 1 Score: 208.0 bits (528), Expect = 8.0e-51 Identity = 104/104 (100.00%), Postives = 104/104 (100.00%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. NCBI nr
Match: gi|449461687|ref|XP_004148573.1| (PREDICTED: probable metal-nicotianamine transporter YSL7 [Cucumis sativus]) HSP 1 Score: 112.8 bits (281), Expect = 3.5e-22 Identity = 60/100 (60.00%), Postives = 73/100 (73.00%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. NCBI nr
Match: gi|659123832|ref|XP_008461864.1| (PREDICTED: probable metal-nicotianamine transporter YSL7 [Cucumis melo]) HSP 1 Score: 112.8 bits (281), Expect = 3.5e-22 Identity = 62/100 (62.00%), Postives = 73/100 (73.00%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. NCBI nr
Match: gi|255582642|ref|XP_002532101.1| (PREDICTED: probable metal-nicotianamine transporter YSL7 [Ricinus communis]) HSP 1 Score: 97.8 bits (242), Expect = 1.2e-17 Identity = 57/112 (50.89%), Postives = 69/112 (61.61%), Query Frame = 1
BLAST of CSPI03G39380.1 vs. NCBI nr
Match: gi|590689771|ref|XP_007043321.1| (YELLOW STRIPE like 7 [Theobroma cacao]) HSP 1 Score: 94.7 bits (234), Expect = 9.9e-17 Identity = 55/104 (52.88%), Postives = 67/104 (64.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
|