|
The following sequences are available for this feature:
Gene sequence (with intron) Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below. TGCCACTGCACTTTACGTTCTTCTCTTTGGTCC mRNA sequence TGCCACTGCACTTTACGTTCTTCTCTTTGGTCC Coding sequence (CDS) TGCCACTGCACTTTACGTTCTTCTCTTTGGTCC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
Match Name | E-value | Identity | Description | |
GO Assignments
This mRNA is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
biological_process |
GO:0008150 |
biological_process |
cellular_component |
GO:0005575 |
cellular_component |
molecular_function |
GO:0003674 |
molecular_function |
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
Feature Name | Unique Name | Type |
CSPI03G06840.1 | CSPI03G06840.1-protein | polypeptide |
The following CDS feature(s) are a part of this mRNA:
Feature Name | Unique Name | Type |
CSPI03G06840.mrna.cds.1 | CSPI03G06840.mrna.cds.1 | CDS |
|