CSPI01G13810.1 (mRNA) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGATCGAGGTCGTGCTCAACGATCGTCTAGGGAAGAAGGTCCGTGTGAAGTGCAACGAGGATGATACGATTGGAGACTTGAAGAAGCTTGTCGCCGCTCAGACCGGAACCCGGACTGAGAAAATCAGGATCCAGAAGTGGTATAATATCTATAAGGATCATATCACTCTTAAGGATTACGAGATTCATGACGGCATGGGGCTGGAACTCTATTACAATTGATTACGTATCGCTGTGAGTTTTTACGGCTTTTCTTAATCTTGATGGGTTATGCTCGCGTGTTGGTTCTTTTATGATTTATCTACTGTTATTTTGTTGTTGGATTCAATTCGTAGAACGTCTTGTTTAGTTTTTATTGGATTTTAGGGTTCGTTTGATGCGATTAAGATGGATCGAAGCGCGTGTTTTTAGACGTTATGTCAATTAATTTTCGATGGATGTGGAACGAGGTTATGTCTCTGGTAACGGTGGATATGAAGCGTCAAACCGCAGTGCAGACACTTTCTGACATAAGGCTCCTGTTCTCTTTCCTTTTTATATTTTGGAGATTTATGTATTCCATTGAAATATGAACTCGGTTACTAGTTTTGAAGTCAAGGTATTTCCTCTGATGAATGGGTGTTTTCTCTCTCCGAGGTTTGGAAATCCTTTGGAAGATGCAGGCCTTGTAATCTTTGGTCTGCTTAACGAACGCTACGCTCAATGTTTTGATGTCCATAAACTGTTTTTTTGTGGAATTAGCAACCCTGTGGATGACAACGCGTTCTTTTGAGCATCTGAAATTCTTTATAAAGGGAGTTGTTTACTTTGAGAAACCTACTTAAAGTTAACCAGATATTTGTTGTGCTCATCTTAA ATGATCGAGGTCGTGCTCAACGATCGTCTAGGGAAGAAGGTCCGTGTGAAGTGCAACGAGGATGATACGATTGGAGACTTGAAGAAGCTTGTCGCCGCTCAGACCGGAACCCGGACTGAGAAAATCAGGATCCAGAAGTGGTATAATATCTATAAGGATCATATCACTCTTAAGGATTACGAGATTCATGACGGCATGGGGCTGGAACTCTATTACAATTGA ATGATCGAGGTCGTGCTCAACGATCGTCTAGGGAAGAAGGTCCGTGTGAAGTGCAACGAGGATGATACGATTGGAGACTTGAAGAAGCTTGTCGCCGCTCAGACCGGAACCCGGACTGAGAAAATCAGGATCCAGAAGTGGTATAATATCTATAAGGATCATATCACTCTTAAGGATTACGAGATTCATGACGGCATGGGGCTGGAACTCTATTACAATTGA
BLAST of CSPI01G13810.1 vs. Swiss-Prot
Match: UBL5_ARATH (Ubiquitin-like protein 5 OS=Arabidopsis thaliana GN=UBL5 PE=3 SV=1) HSP 1 Score: 150.2 bits (378), Expect = 8.8e-36 Identity = 71/73 (97.26%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. Swiss-Prot
Match: UBL5_PSAOB (Ubiquitin-like protein 5 OS=Psammomys obesus GN=UBL5 PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.3e-28 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. Swiss-Prot
Match: UBL5_MOUSE (Ubiquitin-like protein 5 OS=Mus musculus GN=Ubl5 PE=1 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.3e-28 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. Swiss-Prot
Match: UBL5_MESAU (Ubiquitin-like protein 5 OS=Mesocricetus auratus GN=UBL5 PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.3e-28 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. Swiss-Prot
Match: UBL5_BOVIN (Ubiquitin-like protein 5 OS=Bos taurus GN=UBL5 PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.3e-28 Identity = 58/72 (80.56%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TrEMBL
Match: A0A0A0LSS0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G126050 PE=4 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 1.2e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TrEMBL
Match: M4E4Y0_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 151.4 bits (381), Expect = 4.4e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TrEMBL
Match: D7MTG3_ARALL (Ubiquitin family protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_917558 PE=4 SV=1) HSP 1 Score: 151.4 bits (381), Expect = 4.4e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TrEMBL
Match: R0GPM9_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10027479mg PE=4 SV=1) HSP 1 Score: 151.4 bits (381), Expect = 4.4e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TrEMBL
Match: A0A078H902_BRANA (BnaA01g24730D protein OS=Brassica napus GN=BnaA01g24730D PE=4 SV=1) HSP 1 Score: 151.4 bits (381), Expect = 4.4e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TAIR10
Match: AT5G42300.1 (AT5G42300.1 ubiquitin-like protein 5) HSP 1 Score: 150.2 bits (378), Expect = 5.0e-37 Identity = 71/73 (97.26%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. TAIR10
Match: AT3G45180.1 (AT3G45180.1 Ubiquitin-like superfamily protein) HSP 1 Score: 147.1 bits (370), Expect = 4.2e-36 Identity = 70/73 (95.89%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. NCBI nr
Match: gi|449443353|ref|XP_004139444.1| (PREDICTED: ubiquitin-like protein 5 [Cucumis sativus]) HSP 1 Score: 153.3 bits (386), Expect = 1.7e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. NCBI nr
Match: gi|297791835|ref|XP_002863802.1| (ubiquitin family protein [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 151.4 bits (381), Expect = 6.3e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. NCBI nr
Match: gi|226498162|ref|NP_001147132.1| (ubiquitin-like protein 5 [Zea mays]) HSP 1 Score: 151.0 bits (380), Expect = 8.3e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. NCBI nr
Match: gi|937937741|dbj|BAT12654.1| (Os11g0145400, partial [Oryza sativa Japonica Group]) HSP 1 Score: 151.0 bits (380), Expect = 8.3e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CSPI01G13810.1 vs. NCBI nr
Match: gi|514805304|ref|XP_004977514.1| (PREDICTED: ubiquitin-like protein 5 [Setaria italica]) HSP 1 Score: 151.0 bits (380), Expect = 8.3e-34 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following three_prime_UTR feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
|