MELO3C035260.2 (gene) Melon (DHL92) v3.6.1
The following sequences are available for this feature:
Legend: polypeptideCDSexonthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ACAAGGGGTTCGACAGGAAAGTCCTTTCGATCCAATCCATTCTTGGAGTCAAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGGCCGAAATACGGGAAAACTCCATGAAATTCTCGATGGAAACGGAGTTTTTCGAATTCTTCCCGGAACTGGCAGATCATTTCGAGATCTTCTCTAAGACTCTAGGGTTCAATGTGACTATTGTCACTTCGGCCAAGACACAAGATGAGACTTTACCACCGT ACAAGGGGTTCGACAGGAAAGTCCTTTCGATCCAATCCATTCTTGGAGTCAAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGGCCGAAATACGGGAAAACTCCATGAAATTCTCGATGGAAACGGAGTTTTTCGAATTCTTCCCGGAACTGGCAGATCATTTCGAGATCTTCTCTAAGACTCTAGGGTTCAATGTGACTATTGTCACTTCGGCCAAGACACAAGATGAGACTTTACCACCGT ACAAGGGGTTCGACAGGAAAGTCCTTTCGATCCAATCCATTCTTGGAGTCAAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGGCCGAAATACGGGAAAACTCCATGAAATTCTCGATGGAAACGGAGTTTTTCGAATTCTTCCCGGAACTGGCAGATCATTTCGAGATCTTCTCTAAGACTCTAGGGTTCAATGTGACTATTGTCACTTCGGCCAAGACACAAGATGAGACTTTACCACCG TRGSTGKSFRSNPFLESNKDKGYVSDLARESTLRGHEMSNFSFKIIIGIVMSFLNSPAEIRENSMKFSMETEFFEFFPELADHFEIFSKTLGFNVTIVTSAKTQDETLPP
BLAST of MELO3C035260.2 vs. NCBI nr
Match: AEN56134.1 (ribosomal protein L5 (mitochondrion) [Cucumis melo subsp. melo]) HSP 1 Score: 217.6 bits (553), Expect = 2.1e-53 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 0
BLAST of MELO3C035260.2 vs. NCBI nr
Match: YP_004849341.1 (ribosomal protein L5 (mitochondrion) [Cucumis sativus] >ADZ10768.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus]) HSP 1 Score: 196.1 bits (497), Expect = 6.5e-47 Identity = 98/110 (89.09%), Postives = 104/110 (94.55%), Query Frame = 0
BLAST of MELO3C035260.2 vs. NCBI nr
Match: AAP33159.1 (ribosomal protein L5 (mitochondrion) [Cucumis sativus] >AAP33161.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus] >AAP33162.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus]) HSP 1 Score: 190.7 bits (483), Expect = 2.7e-45 Identity = 96/108 (88.89%), Postives = 102/108 (94.44%), Query Frame = 0
BLAST of MELO3C035260.2 vs. NCBI nr
Match: AFY03535.1 (ribosomal protein L5, partial (mitochondrion) [Lagenaria siceraria]) HSP 1 Score: 171.0 bits (432), Expect = 2.2e-39 Identity = 89/109 (81.65%), Postives = 94/109 (86.24%), Query Frame = 0
BLAST of MELO3C035260.2 vs. NCBI nr
Match: XP_023512239.1 (uncharacterized protein LOC111777027 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 168.7 bits (426), Expect = 1.1e-38 Identity = 87/109 (79.82%), Postives = 93/109 (85.32%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TAIR10
Match: AT2G07725.1 (Ribosomal L5P family protein) HSP 1 Score: 159.1 bits (401), Expect = 1.6e-39 Identity = 83/108 (76.85%), Postives = 90/108 (83.33%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TAIR10
Match: ATMG00210.1 (ribosomal protein L5) HSP 1 Score: 159.1 bits (401), Expect = 1.6e-39 Identity = 83/108 (76.85%), Postives = 90/108 (83.33%), Query Frame = 0
BLAST of MELO3C035260.2 vs. Swiss-Prot
Match: sp|P49388|RM05_BRANA (60S ribosomal protein L5, mitochondrial OS=Brassica napus OX=3708 GN=RPL5 PE=3 SV=2) HSP 1 Score: 158.3 bits (399), Expect = 4.9e-38 Identity = 83/108 (76.85%), Postives = 90/108 (83.33%), Query Frame = 0
BLAST of MELO3C035260.2 vs. Swiss-Prot
Match: sp|P42793|RM05_ARATH (60S ribosomal protein L5, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=RPL5 PE=2 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 7.1e-37 Identity = 81/107 (75.70%), Postives = 89/107 (83.18%), Query Frame = 0
BLAST of MELO3C035260.2 vs. Swiss-Prot
Match: sp|Q05492|RM05_OENBE (60S ribosomal protein L5, mitochondrial OS=Oenothera berteroana OX=3950 GN=RPL5 PE=2 SV=2) HSP 1 Score: 152.5 bits (384), Expect = 2.7e-36 Identity = 82/107 (76.64%), Postives = 88/107 (82.24%), Query Frame = 0
BLAST of MELO3C035260.2 vs. Swiss-Prot
Match: sp|P51409|RM05_SOLTU (60S ribosomal protein L5, mitochondrial OS=Solanum tuberosum OX=4113 GN=RPL5 PE=2 SV=2) HSP 1 Score: 146.7 bits (369), Expect = 1.5e-34 Identity = 81/108 (75.00%), Postives = 87/108 (80.56%), Query Frame = 0
BLAST of MELO3C035260.2 vs. Swiss-Prot
Match: sp|P26860|RM05_MARPO (60S ribosomal protein L5, mitochondrial OS=Marchantia polymorpha OX=3197 GN=RPL5 PE=3 SV=2) HSP 1 Score: 109.8 bits (273), Expect = 2.0e-23 Identity = 62/111 (55.86%), Postives = 79/111 (71.17%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TrEMBL
Match: tr|G3EU44|G3EU44_CUCME (Ribosomal protein L5 OS=Cucumis melo subsp. melo OX=412675 GN=rpl5 PE=4 SV=1) HSP 1 Score: 217.6 bits (553), Expect = 1.4e-53 Identity = 110/110 (100.00%), Postives = 110/110 (100.00%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TrEMBL
Match: tr|G3EIZ3|G3EIZ3_CUCSA (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=4 SV=1) HSP 1 Score: 196.1 bits (497), Expect = 4.3e-47 Identity = 98/110 (89.09%), Postives = 104/110 (94.55%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TrEMBL
Match: tr|Q7Y6H0|Q7Y6H0_CUCSA (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=4 SV=1) HSP 1 Score: 190.7 bits (483), Expect = 1.8e-45 Identity = 96/108 (88.89%), Postives = 102/108 (94.44%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TrEMBL
Match: tr|K7Z325|K7Z325_LAGSI (Ribosomal protein L5 (Fragment) OS=Lagenaria siceraria OX=3668 PE=4 SV=1) HSP 1 Score: 171.0 bits (432), Expect = 1.5e-39 Identity = 89/109 (81.65%), Postives = 94/109 (86.24%), Query Frame = 0
BLAST of MELO3C035260.2 vs. TrEMBL
Match: tr|A0A288W768|A0A288W768_BUPFA (Ribosomal protein L5 OS=Bupleurum falcatum OX=46367 GN=rpl5 PE=4 SV=1) HSP 1 Score: 166.8 bits (421), Expect = 2.8e-38 Identity = 87/109 (79.82%), Postives = 93/109 (85.32%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon v3.6.1
Date Performed: 2018-09-25
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |