MELO3C031632.2 (gene) Melon (DHL92) v3.6.1
The following sequences are available for this feature:
Legend: CDSexonthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCAACTGACGCTACTCTGTGCGCAAACAACTGTGGGTTTTATGGAAATCCGAACAATCAAAACTTGTGCTCCGCTTGTTACATTGCTTTCCTCAAAGAAACCGGCGTAAAATATTTTGAGCAACAAATAAGCTCAAAAAGTAAAATTAATCTTGAAACGAGACAATCTTCTTCTTCTGGATCATTGGAGAGTCCCGAAACGTGTGTTCACAATGATCCAGAGCCGTCGAAAACCAAAAATAGATGCGAAATTTGCGGGAAGAGGGTCGGAATCGTTGGATTTAGTTGCCGGTGTGGAGGTTGTTTTTGCGGCAAACATAGGTATCCTGAAGAGCATTCGTGCGGCTTTGATCACAAGGAGGATGGGCGGATGATTTTGGCCAAACAAATTGTTGAATGCAAGGCTGATAAATTGGAGTTTAGGG ATGGCAACTGACGCTACTCTGTGCGCAAACAACTGTGGGTTTTATGGAAATCCGAACAATCAAAACTTGTGCTCCGCTTGTTACATTGCTTTCCTCAAAGAAACCGGCGTAAAATATTTTGAGCAACAAATAAGCTCAAAAAGTAAAATTAATCTTGAAACGAGACAATCTTCTTCTTCTGGATCATTGGAGAGTCCCGAAACGTGTGTTCACAATGATCCAGAGCCGTCGAAAACCAAAAATAGATGCGAAATTTGCGGGAAGAGGGTCGGAATCGTTGGATTTAGTTGCCGGTGTGGAGGTTGTTTTTGCGGCAAACATAGGTATCCTGAAGAGCATTCGTGCGGCTTTGATCACAAGGAGGATGGGCGGATGATTTTGGCCAAACAAATTGTTGAATGCAAGGCTGATAAATTGGAGTTTAGGG ATGGCAACTGACGCTACTCTGTGCGCAAACAACTGTGGGTTTTATGGAAATCCGAACAATCAAAACTTGTGCTCCGCTTGTTACATTGCTTTCCTCAAAGAAACCGGCGTAAAATATTTTGAGCAACAAATAAGCTCAAAAAGTAAAATTAATCTTGAAACGAGACAATCTTCTTCTTCTGGATCATTGGAGAGTCCCGAAACGTGTGTTCACAATGATCCAGAGCCGTCGAAAACCAAAAATAGATGCGAAATTTGCGGGAAGAGGGTCGGAATCGTTGGATTTAGTTGCCGGTGTGGAGGTTGTTTTTGCGGCAAACATAGGTATCCTGAAGAGCATTCGTGCGGCTTTGATCACAAGGAGGATGGGCGGATGATTTTGGCCAAACAAATTGTTGAATGCAAGGCTGATAAATTGGAGTTTAGG MATDATLCANNCGFYGNPNNQNLCSACYIAFLKETGVKYFEQQISSKSKINLETRQSSSSGSLESPETCVHNDPEPSKTKNRCEICGKRVGIVGFSCRCGGCFCGKHRYPEEHSCGFDHKEDGRMILAKQIVECKADKLEFR
BLAST of MELO3C031632.2 vs. NCBI nr
Match: XP_008439393.1 (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 10-like [Cucumis melo]) HSP 1 Score: 303.9 bits (777), Expect = 2.8e-79 Identity = 142/142 (100.00%), Postives = 142/142 (100.00%), Query Frame = 0
BLAST of MELO3C031632.2 vs. NCBI nr
Match: XP_008439392.1 (PREDICTED: zinc finger A20 and AN1 domain-containing stress-associated protein 10-like [Cucumis melo]) HSP 1 Score: 265.0 bits (676), Expect = 1.5e-67 Identity = 122/142 (85.92%), Postives = 132/142 (92.96%), Query Frame = 0
BLAST of MELO3C031632.2 vs. NCBI nr
Match: KGN57296.1 (hypothetical protein Csa_3G177400 [Cucumis sativus]) HSP 1 Score: 240.0 bits (611), Expect = 5.0e-60 Identity = 111/139 (79.86%), Postives = 121/139 (87.05%), Query Frame = 0
BLAST of MELO3C031632.2 vs. NCBI nr
Match: KGN57297.1 (hypothetical protein Csa_3G177900 [Cucumis sativus]) HSP 1 Score: 230.3 bits (586), Expect = 4.0e-57 Identity = 106/139 (76.26%), Postives = 116/139 (83.45%), Query Frame = 0
BLAST of MELO3C031632.2 vs. NCBI nr
Match: XP_022141121.1 (zinc finger A20 and AN1 domain-containing stress-associated protein 5-like [Momordica charantia]) HSP 1 Score: 147.5 bits (371), Expect = 3.4e-32 Identity = 81/163 (49.69%), Postives = 92/163 (56.44%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TAIR10
Match: AT4G25380.1 (stress-associated protein 10) HSP 1 Score: 113.2 bits (282), Expect = 1.3e-25 Identity = 63/138 (45.65%), Postives = 76/138 (55.07%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TAIR10
Match: AT4G12040.1 (A20/AN1-like zinc finger family protein) HSP 1 Score: 106.3 bits (264), Expect = 1.6e-23 Identity = 63/161 (39.13%), Postives = 83/161 (51.55%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TAIR10
Match: AT4G22820.1 (A20/AN1-like zinc finger family protein) HSP 1 Score: 103.6 bits (257), Expect = 1.0e-22 Identity = 60/159 (37.74%), Postives = 81/159 (50.94%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TAIR10
Match: AT2G36320.1 (A20/AN1-like zinc finger family protein) HSP 1 Score: 100.5 bits (249), Expect = 8.7e-22 Identity = 59/154 (38.31%), Postives = 74/154 (48.05%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TAIR10
Match: AT1G12440.1 (A20/AN1-like zinc finger family protein) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-21 Identity = 59/160 (36.88%), Postives = 76/160 (47.50%), Query Frame = 0
BLAST of MELO3C031632.2 vs. Swiss-Prot
Match: sp|Q9STJ9|SAP10_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 10 OS=Arabidopsis thaliana OX=3702 GN=SAP10 PE=1 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 2.3e-24 Identity = 63/138 (45.65%), Postives = 76/138 (55.07%), Query Frame = 0
BLAST of MELO3C031632.2 vs. Swiss-Prot
Match: sp|Q9SZ69|SAP7_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 7 OS=Arabidopsis thaliana OX=3702 GN=SAP7 PE=1 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 2.8e-22 Identity = 63/161 (39.13%), Postives = 83/161 (51.55%), Query Frame = 0
BLAST of MELO3C031632.2 vs. Swiss-Prot
Match: sp|Q852K5|SAP6_ORYSJ (Zinc finger A20 and AN1 domain-containing stress-associated protein 6 OS=Oryza sativa subsp. japonica OX=39947 GN=SAP6 PE=2 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 3.7e-22 Identity = 57/136 (41.91%), Postives = 76/136 (55.88%), Query Frame = 0
BLAST of MELO3C031632.2 vs. Swiss-Prot
Match: sp|O49663|SAP9_ARATH (Zinc finger A20 and AN1 domain-containing stress-associated protein 9 OS=Arabidopsis thaliana OX=3702 GN=SAP9 PE=2 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.8e-21 Identity = 60/159 (37.74%), Postives = 81/159 (50.94%), Query Frame = 0
BLAST of MELO3C031632.2 vs. Swiss-Prot
Match: sp|Q7Y1W9|SAP9_ORYSJ (Zinc finger A20 and AN1 domain-containing stress-associated protein 9 OS=Oryza sativa subsp. japonica OX=39947 GN=SAP9 PE=2 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.8e-21 Identity = 56/140 (40.00%), Postives = 74/140 (52.86%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TrEMBL
Match: tr|A0A1S3AZB6|A0A1S3AZB6_CUCME (zinc finger A20 and AN1 domain-containing stress-associated protein 10-like OS=Cucumis melo OX=3656 GN=LOC103484208 PE=4 SV=1) HSP 1 Score: 303.9 bits (777), Expect = 1.9e-79 Identity = 142/142 (100.00%), Postives = 142/142 (100.00%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TrEMBL
Match: tr|A0A1S3AZB4|A0A1S3AZB4_CUCME (zinc finger A20 and AN1 domain-containing stress-associated protein 10-like OS=Cucumis melo OX=3656 GN=LOC103484207 PE=4 SV=1) HSP 1 Score: 265.0 bits (676), Expect = 9.7e-68 Identity = 122/142 (85.92%), Postives = 132/142 (92.96%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TrEMBL
Match: tr|A0A0A0LB47|A0A0A0LB47_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G177400 PE=4 SV=1) HSP 1 Score: 240.0 bits (611), Expect = 3.3e-60 Identity = 111/139 (79.86%), Postives = 121/139 (87.05%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TrEMBL
Match: tr|A0A0A0L9J1|A0A0A0L9J1_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G177900 PE=4 SV=1) HSP 1 Score: 230.3 bits (586), Expect = 2.6e-57 Identity = 106/139 (76.26%), Postives = 116/139 (83.45%), Query Frame = 0
BLAST of MELO3C031632.2 vs. TrEMBL
Match: tr|A0A1S3ZRB5|A0A1S3ZRB5_TOBAC (putative zinc finger A20 and AN1 domain-containing stress-associated protein 8 OS=Nicotiana tabacum OX=4097 GN=LOC107789534 PE=4 SV=1) HSP 1 Score: 138.3 bits (347), Expect = 1.4e-29 Identity = 68/141 (48.23%), Postives = 87/141 (61.70%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon v3.6.1
Date Performed: 2018-09-25
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |