MELO3C030625.2 (gene) Melon (DHL92) v3.6.1
The following sequences are available for this feature:
Legend: five_prime_UTRexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATTAAGGAAAGAGATATTGTCAAGCACACTGAATCGATTGTGGATGTTCCCACATAAAAGGCTATGCTCGAGCGTGTGGTCAATGCCTTGGGTGTGGCCATTAATGGAAGAGAGGCTCTCAACGATCACGAGCGAAGACGTGTCAAAGTGAAAGCCCCTGTGATCATTGAATGTAAATCAATGCACAAACCTTTACAAACAGGGTTAAAAGCGATGGATAGCCTAGTTCCTATATGTCGGGGCCAACGA ATTAAGGAAAGAGATATTGTCAAGCACACTGAATCGATTGTGGATGTTCCCACATAAAAGGCTATGCTCGAGCGTGTGGTCAATGCCTTGGGTGTGGCCATTAATGGAAGAGAGGCTCTCAACGATCACGAGCGAAGACGTGTCAAAGTGAAAGCCCCTGTGATCATTGAATGTAAATCAATGCACAAACCTTTACAAACAGGGTTAAAAGCGATGGATAGCCTAGTTCCTATATGTCGGGGCCAACGA ATGCTCGAGCGTGTGGTCAATGCCTTGGGTGTGGCCATTAATGGAAGAGAGGCTCTCAACGATCACGAGCGAAGACGTGTCAAAGTGAAAGCCCCTGTGATCATTGAATGTAAATCAATGCACAAACCTTTACAAACAGGGTTAAAAGCGATGGATAGCCTAGTTCCTATATGTCGGGGCCAACGA MLERVVNALGVAINGREALNDHERRRVKVKAPVIIECKSMHKPLQTGLKAMDSLVPICRGQR
BLAST of MELO3C030625.2 vs. NCBI nr
Match: XP_025650675.1 (uncharacterized protein LOC112745747 [Arachis hypogaea]) HSP 1 Score: 96.7 bits (239), Expect = 3.0e-17 Identity = 49/62 (79.03%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. NCBI nr
Match: XP_010647312.1 (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC104878494 [Vitis vinifera]) HSP 1 Score: 96.3 bits (238), Expect = 3.9e-17 Identity = 49/62 (79.03%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. NCBI nr
Match: AAQ74470.1 (F1-ATPase alpha subunit, partial (mitochondrion) [Aletris farinosa]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. NCBI nr
Match: ACM48843.1 (ATPase alpha subunit, partial (mitochondrion) [Aletris lutea]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. NCBI nr
Match: AAT69068.1 (F1-ATPase alpha subunit, partial (mitochondrion) [Schizanthus pinnatus]) HSP 1 Score: 95.1 bits (235), Expect = 8.8e-17 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TAIR10
Match: AT2G07698.1 (ATPase, F1 complex, alpha subunit protein) HSP 1 Score: 90.5 bits (223), Expect = 3.9e-19 Identity = 44/62 (70.97%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TAIR10
Match: ATMG01190.1 (ATP synthase subunit 1) HSP 1 Score: 90.5 bits (223), Expect = 3.9e-19 Identity = 44/62 (70.97%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TAIR10
Match: ATCG00120.1 (ATP synthase subunit alpha) HSP 1 Score: 61.2 bits (147), Expect = 2.5e-10 Identity = 31/61 (50.82%), Postives = 44/61 (72.13%), Query Frame = 0
BLAST of MELO3C030625.2 vs. Swiss-Prot
Match: sp|Q06735|ATPAM_BETVU (ATP synthase subunit alpha, mitochondrial OS=Beta vulgaris OX=161934 GN=ATPA PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.7e-19 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. Swiss-Prot
Match: sp|P18260|ATPAM_HELAN (ATP synthase subunit alpha, mitochondrial OS=Helianthus annuus OX=4232 GN=ATPA PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.7e-19 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. Swiss-Prot
Match: sp|P05493|ATPAM_PEA (ATP synthase subunit alpha, mitochondrial OS=Pisum sativum OX=3888 GN=ATPA PE=3 SV=2) HSP 1 Score: 94.7 bits (234), Expect = 3.7e-19 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. Swiss-Prot
Match: sp|P24459|ATPAM_PHAVU (ATP synthase subunit alpha, mitochondrial OS=Phaseolus vulgaris OX=3885 GN=ATPA PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.7e-19 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. Swiss-Prot
Match: sp|Q01915|ATPAM_SOYBN (ATP synthase subunit alpha, mitochondrial OS=Glycine max OX=3847 GN=ATPA PE=3 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.7e-19 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TrEMBL
Match: tr|F6I2F8|F6I2F8_VITVI (Uncharacterized protein OS=Vitis vinifera OX=29760 GN=VIT_00s0733g00010 PE=3 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 2.6e-17 Identity = 49/62 (79.03%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TrEMBL
Match: tr|Q5VL97|Q5VL97_ALEFA (ATP synthase subunit alpha (Fragment) OS=Aletris farinosa OX=167569 GN=atpA PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.4e-17 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TrEMBL
Match: tr|B9UZE1|B9UZE1_9LILI (ATP synthase subunit alpha (Fragment) OS=Aletris lutea OX=119991 GN=atpA PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.4e-17 Identity = 48/62 (77.42%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TrEMBL
Match: tr|M8C108|M8C108_AEGTA (ATP synthase subunit alpha, mitochondrial OS=Aegilops tauschii OX=37682 GN=F775_20153 PE=3 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 5.8e-17 Identity = 47/62 (75.81%), Postives = 56/62 (90.32%), Query Frame = 0
BLAST of MELO3C030625.2 vs. TrEMBL
Match: tr|R4V0L9|R4V0L9_9GENT (Atp1 (Fragment) OS=Voyria aurantiaca OX=931104 GN=atp1 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 5.8e-17 Identity = 49/62 (79.03%), Postives = 54/62 (87.10%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon v3.6.1
Date Performed: 2018-09-25
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|