MELO3C025277 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAACAAGTCCAAGGATGGGTCAAATTACGAATCAAGAACCAGTATGATAGAATAAGAGAGAGTATGAATGAGATCTTTCGGCAGACAGGAAGGGGAATAGCCCTAGCCGCTTGCATTCAGTCAGAATCCAAAAGTAGGAGTAGGGGAGTAGGTCAGATCAAGACTAATCTGTCTGCTAACTCGATTTTGAGTCTTGTTGAGGTCACTATTTTAGTAAATGATGCAGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTCGAAATAGTGGAAGCCAACTTGAGGAAAGTTCAGGGTAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACAAGCTAGGACATGA ATGGATAAACAAGTCCAAGGATGGGTCAAATTACGAATCAAGAACCAGTATGATAGAATAAGAGAGAGTATGAATGAGATCTTTCGGCAGACAGGAAGGGGAATAGCCCTAGCCGCTTGCATTCAGTCAGAATCCAAAAGTAGGAGTAGGGGAGTAGGTCAGATCAAGACTAATCTGTCTGCTAACTCGATTTTGAGTCTTGTTGAGGTCACTATTTTAGTAAATGATGCAGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTCGAAATAGTGGAAGCCAACTTGAGGAAAGTTCAGGGTAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACAAGCTAGGACATGA ATGGATAAACAAGTCCAAGGATGGGTCAAATTACGAATCAAGAACCAGTATGATAGAATAAGAGAGAGTATGAATGAGATCTTTCGGCAGACAGGAAGGGGAATAGCCCTAGCCGCTTGCATTCAGTCAGAATCCAAAAGTAGGAGTAGGGGAGTAGGTCAGATCAAGACTAATCTGTCTGCTAACTCGATTTTGAGTCTTGTTGAGGTCACTATTTTAGTAAATGATGCAGAGAAGGCTAGTGACATTGATCCACAAGAAGCTCAGCAAACTCTCGAAATAGTGGAAGCCAACTTGAGGAAAGTTCAGGGTAAGAGACAAACAATCGAGGCAAATTTAGCTCTCAGACAAGCTAGGACATGA MDKQVQGWVKLRIKNQYDRIRESMNEIFRQTGRGIALAACIQSESKSRSRGVGQIKTNLSANSILSLVEVTILVNDAEKASDIDPQEAQQTLEIVEANLRKVQGKRQTIEANLALRQART*
BLAST of MELO3C025277 vs. Swiss-Prot
Match: ATPE_CUCSA (ATP synthase epsilon chain, chloroplastic OS=Cucumis sativus GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.2e-19 Identity = 49/52 (94.23%), Postives = 48/52 (92.31%), Query Frame = 1
BLAST of MELO3C025277 vs. Swiss-Prot
Match: ATPE_ARATH (ATP synthase epsilon chain, chloroplastic OS=Arabidopsis thaliana GN=atpE PE=1 SV=2) HSP 1 Score: 91.7 bits (226), Expect = 6.1e-18 Identity = 46/52 (88.46%), Postives = 47/52 (90.38%), Query Frame = 1
BLAST of MELO3C025277 vs. Swiss-Prot
Match: ATPE_GOSBA (ATP synthase epsilon chain, chloroplastic OS=Gossypium barbadense GN=atpE PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 45/52 (86.54%), Postives = 46/52 (88.46%), Query Frame = 1
BLAST of MELO3C025277 vs. Swiss-Prot
Match: ATPE_EUCGG (ATP synthase epsilon chain, chloroplastic OS=Eucalyptus globulus subsp. globulus GN=atpE PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 44/52 (84.62%), Postives = 47/52 (90.38%), Query Frame = 1
BLAST of MELO3C025277 vs. Swiss-Prot
Match: ATPE_GOSHI (ATP synthase epsilon chain, chloroplastic OS=Gossypium hirsutum GN=atpE PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 45/52 (86.54%), Postives = 46/52 (88.46%), Query Frame = 1
BLAST of MELO3C025277 vs. TrEMBL
Match: A0A0S2IGL3_CUCPE (AtpE OS=Cucurbita pepo var. ozarkana GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. TrEMBL
Match: A0A0S2IGX0_CUCPE (AtpE OS=Cucurbita pepo var. texana GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. TrEMBL
Match: A0A0S2IDX1_9ROSI (AtpE OS=Cucurbita argyrosperma GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. TrEMBL
Match: A0A0S2IEZ8_9ROSI (AtpE OS=Cucurbita ecuadorensis GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. TrEMBL
Match: W8E6W2_9ROSI (ATP synthase CF1 epsilon subunit OS=Cucumis hystrix GN=atpE PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. TAIR10
Match: ATCG00470.1 (ATCG00470.1 ATP synthase epsilon chain) HSP 1 Score: 91.7 bits (226), Expect = 3.4e-19 Identity = 46/52 (88.46%), Postives = 47/52 (90.38%), Query Frame = 1
BLAST of MELO3C025277 vs. NCBI nr
Match: gi|952954489|gb|ALO21851.1| (AtpE (plastid) [Cucurbita argyrosperma subsp. sororia]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. NCBI nr
Match: gi|68164809|ref|YP_247605.1| (ATP synthase CF1 epsilon subunit [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. NCBI nr
Match: gi|952954770|gb|ALO22128.1| (AtpE (plastid) [Cucurbita ficifolia]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. NCBI nr
Match: gi|952955568|gb|ALO22914.1| (AtpE (plastid) [Cucurbita pedatifolia]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
BLAST of MELO3C025277 vs. NCBI nr
Match: gi|952954676|gb|ALO22035.1| (AtpE (plastid) [Cucurbita ecuadorensis]) HSP 1 Score: 95.5 bits (236), Expect = 6.7e-17 Identity = 49/52 (94.23%), Postives = 50/52 (96.15%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|