MELO3C019005 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGTTGTCTCGTATAGGAGTTCACGATGTCACCGGTGTCGAGTTGATTGATTCGCCTCCTTTGGTGAGTCGTGTTGATCCTCATAATTTGCCTTTCTTTGATCATGTTTTTGATTTGGCGTTTACTGCTCATTTGGCTGAGGCGTTGTTTCCGTCTTGA ATGGCGTTGTCTCGTATAGGAGTTCACGATGTCACCGGTGTCGAGTTGATTGATTCGCCTCCTTTGGTGAGTCGTGTTGATCCTCATAATTTGCCTTTCTTTGATCATGTTTTTGATTTGGCGTTTACTGCTCATTTGGCTGAGGCGTTGTTTCCGTCTTGA ATGGCGTTGTCTCGTATAGGAGTTCACGATGTCACCGGTGTCGAGTTGATTGATTCGCCTCCTTTGGTGAGTCGTGTTGATCCTCATAATTTGCCTTTCTTTGATCATGTTTTTGATTTGGCGTTTACTGCTCATTTGGCTGAGGCGTTGTTTCCGTCTTGA MALSRIGVHDVTGVELIDSPPLVSRVDPHNLPFFDHVFDLAFTAHLAEALFPS*
BLAST of MELO3C019005 vs. TrEMBL
Match: A0A0A0K6X5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G045500 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 9.1e-21 Identity = 50/53 (94.34%), Postives = 52/53 (98.11%), Query Frame = 1
BLAST of MELO3C019005 vs. TrEMBL
Match: E5GC82_CUCME (Methyltransferase OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.2e-20 Identity = 50/53 (94.34%), Postives = 51/53 (96.23%), Query Frame = 1
BLAST of MELO3C019005 vs. TrEMBL
Match: A0A059DGX2_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_A01742 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 1.8e-16 Identity = 45/53 (84.91%), Postives = 46/53 (86.79%), Query Frame = 1
BLAST of MELO3C019005 vs. TrEMBL
Match: W9RLJ6_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_008732 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 8.8e-16 Identity = 41/53 (77.36%), Postives = 48/53 (90.57%), Query Frame = 1
BLAST of MELO3C019005 vs. TrEMBL
Match: A0A067E1N5_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g027039mg PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.1e-15 Identity = 43/53 (81.13%), Postives = 46/53 (86.79%), Query Frame = 1
BLAST of MELO3C019005 vs. TAIR10
Match: AT2G16030.1 (AT2G16030.1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein) HSP 1 Score: 88.2 bits (217), Expect = 1.7e-18 Identity = 42/52 (80.77%), Postives = 43/52 (82.69%), Query Frame = 1
BLAST of MELO3C019005 vs. TAIR10
Match: AT4G26730.1 (AT4G26730.1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein) HSP 1 Score: 87.4 bits (215), Expect = 2.9e-18 Identity = 41/52 (78.85%), Postives = 42/52 (80.77%), Query Frame = 1
BLAST of MELO3C019005 vs. TAIR10
Match: AT1G24480.1 (AT1G24480.1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein) HSP 1 Score: 49.7 bits (117), Expect = 6.7e-07 Identity = 23/51 (45.10%), Postives = 30/51 (58.82%), Query Frame = 1
BLAST of MELO3C019005 vs. NCBI nr
Match: gi|449453660|ref|XP_004144574.1| (PREDICTED: uncharacterized protein LOC101220368 [Cucumis sativus]) HSP 1 Score: 106.7 bits (265), Expect = 1.3e-20 Identity = 50/53 (94.34%), Postives = 52/53 (98.11%), Query Frame = 1
BLAST of MELO3C019005 vs. NCBI nr
Match: gi|307136248|gb|ADN34081.1| (methyltransferase [Cucumis melo subsp. melo]) HSP 1 Score: 106.3 bits (264), Expect = 1.7e-20 Identity = 50/53 (94.34%), Postives = 51/53 (96.23%), Query Frame = 1
BLAST of MELO3C019005 vs. NCBI nr
Match: gi|659133738|ref|XP_008466880.1| (PREDICTED: uncharacterized protein LOC103504200, partial [Cucumis melo]) HSP 1 Score: 106.3 bits (264), Expect = 1.7e-20 Identity = 50/53 (94.34%), Postives = 51/53 (96.23%), Query Frame = 1
BLAST of MELO3C019005 vs. NCBI nr
Match: gi|659072244|ref|XP_008464338.1| (PREDICTED: uncharacterized protein LOC103502244 [Cucumis melo]) HSP 1 Score: 104.8 bits (260), Expect = 5.0e-20 Identity = 49/53 (92.45%), Postives = 50/53 (94.34%), Query Frame = 1
BLAST of MELO3C019005 vs. NCBI nr
Match: gi|659133779|ref|XP_008466896.1| (PREDICTED: uncharacterized protein LOC103504231, partial [Cucumis melo]) HSP 1 Score: 104.8 bits (260), Expect = 5.0e-20 Identity = 50/53 (94.34%), Postives = 51/53 (96.23%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|