MELO3C015346 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATAGAAGAACTAAGAAAAGACCGGGCGACTCTAATAAGAGAAGAGTTAGATTTATTAAAGATAGTGAGCGAAGAGAATATAGAGCACTACAAATCATTGACGGTAGATGCGAAGAAATCTTCATCTCAATATAAGAAAGAGGTAGAAAATTGCAACATTGGAGTTAGAACTTGTGAGGAAGCAAGAGAAAGAGCTCAAGAAGAGCTTGTTGAAGAATGCAAACTCACTGCTTTGTGGCAAAAAAGGGCTGAAATGCTTGCAAAACCATGA ATGATAGAAGAACTAAGAAAAGACCGGGCGACTCTAATAAGAGAAGAGTTAGATTTATTAAAGATAGTGAGCGAAGAGAATATAGAGCACTACAAATCATTGACGGTAGATGCGAAGAAATCTTCATCTCAATATAAGAAAGAGGTAGAAAATTGCAACATTGGAGTTAGAACTTGTGAGGAAGCAAGAGAAAGAGCTCAAGAAGAGCTTGTTGAAGAATGCAAACTCACTGCTTTGTGGCAAAAAAGGGCTGAAATGCTTGCAAAACCATGA ATGATAGAAGAACTAAGAAAAGACCGGGCGACTCTAATAAGAGAAGAGTTAGATTTATTAAAGATAGTGAGCGAAGAGAATATAGAGCACTACAAATCATTGACGGTAGATGCGAAGAAATCTTCATCTCAATATAAGAAAGAGGTAGAAAATTGCAACATTGGAGTTAGAACTTGTGAGGAAGCAAGAGAAAGAGCTCAAGAAGAGCTTGTTGAAGAATGCAAACTCACTGCTTTGTGGCAAAAAAGGGCTGAAATGCTTGCAAAACCATGA MIEELRKDRATLIREELDLLKIVSEENIEHYKSLTVDAKKSSSQYKKEVENCNIGVRTCEEARERAQEELVEECKLTALWQKRAEMLAKP*
BLAST of MELO3C015346 vs. TrEMBL
Match: A0A0A0M1L2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G571290 PE=4 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 1.0e-32 Identity = 74/90 (82.22%), Postives = 81/90 (90.00%), Query Frame = 1
BLAST of MELO3C015346 vs. TrEMBL
Match: A0A061E4K7_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_008923 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 9.9e-20 Identity = 50/85 (58.82%), Postives = 64/85 (75.29%), Query Frame = 1
BLAST of MELO3C015346 vs. TrEMBL
Match: A0A0S3S5E9_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.05G147400 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 9.9e-20 Identity = 46/82 (56.10%), Postives = 65/82 (79.27%), Query Frame = 1
BLAST of MELO3C015346 vs. TrEMBL
Match: V7BPV4_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_006G094800g PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 9.9e-20 Identity = 47/82 (57.32%), Postives = 65/82 (79.27%), Query Frame = 1
BLAST of MELO3C015346 vs. TrEMBL
Match: A0A0L9VCU8_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan09g155000 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 9.9e-20 Identity = 46/82 (56.10%), Postives = 65/82 (79.27%), Query Frame = 1
BLAST of MELO3C015346 vs. TAIR10
Match: AT2G24290.1 (AT2G24290.1 Protein of unknown function (DUF1068)) HSP 1 Score: 78.2 bits (191), Expect = 2.9e-15 Identity = 38/85 (44.71%), Postives = 51/85 (60.00%), Query Frame = 1
BLAST of MELO3C015346 vs. TAIR10
Match: AT4G30996.1 (AT4G30996.1 Protein of unknown function (DUF1068)) HSP 1 Score: 77.8 bits (190), Expect = 3.9e-15 Identity = 36/82 (43.90%), Postives = 51/82 (62.20%), Query Frame = 1
BLAST of MELO3C015346 vs. TAIR10
Match: AT2G32580.1 (AT2G32580.1 Protein of unknown function (DUF1068)) HSP 1 Score: 75.5 bits (184), Expect = 1.9e-14 Identity = 36/82 (43.90%), Postives = 55/82 (67.07%), Query Frame = 1
BLAST of MELO3C015346 vs. TAIR10
Match: AT1G05070.1 (AT1G05070.1 Protein of unknown function (DUF1068)) HSP 1 Score: 70.9 bits (172), Expect = 4.7e-13 Identity = 36/82 (43.90%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of MELO3C015346 vs. TAIR10
Match: AT4G04360.1 (AT4G04360.1 Protein of unknown function (DUF1068)) HSP 1 Score: 66.6 bits (161), Expect = 8.9e-12 Identity = 32/82 (39.02%), Postives = 51/82 (62.20%), Query Frame = 1
BLAST of MELO3C015346 vs. NCBI nr
Match: gi|700211010|gb|KGN66106.1| (hypothetical protein Csa_1G571290 [Cucumis sativus]) HSP 1 Score: 147.1 bits (370), Expect = 1.5e-32 Identity = 74/90 (82.22%), Postives = 81/90 (90.00%), Query Frame = 1
BLAST of MELO3C015346 vs. NCBI nr
Match: gi|502113418|ref|XP_004494644.1| (PREDICTED: uncharacterized protein LOC101512065 [Cicer arietinum]) HSP 1 Score: 105.1 bits (261), Expect = 6.4e-20 Identity = 49/84 (58.33%), Postives = 64/84 (76.19%), Query Frame = 1
BLAST of MELO3C015346 vs. NCBI nr
Match: gi|920711642|gb|KOM52891.1| (hypothetical protein LR48_Vigan09g155000 [Vigna angularis]) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 46/82 (56.10%), Postives = 65/82 (79.27%), Query Frame = 1
BLAST of MELO3C015346 vs. NCBI nr
Match: gi|593693078|ref|XP_007147081.1| (hypothetical protein PHAVU_006G094800g [Phaseolus vulgaris]) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 47/82 (57.32%), Postives = 65/82 (79.27%), Query Frame = 1
BLAST of MELO3C015346 vs. NCBI nr
Match: gi|590692543|ref|XP_007044084.1| (Uncharacterized protein TCM_008923 [Theobroma cacao]) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 50/85 (58.82%), Postives = 64/85 (75.29%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|