MELO3C013894 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.CAAATGTTCATCAAAGTTATATAAAAGAGCTACGAGAAATGGGAAGGCCAATTCTTGTCACCCATGGTGGTGCCTTTGGAGATGTCACCTTGTTCACTTCCAGGGCTTATTTTTGCTTTCAACCATCATTCTTTCCGTCTCTCTCATTTCGATGATCATATTTGCTTGTAGCGACTCTCATAAGAAAAAGAGAAGATATGGTGGTGGCGGCGGCGGTGGAGGTTGCGGGGGCGACGGTGGTGGAGGTGGTGGAGGTTGTGGCGGTGGCGGAGGAGGTGGGGGCTGTGGCGGCGGAGGTGGAGGTGGATGTTAAAGACATACATGTTTGGTCTCCCTTATATTTGTTTCATTAGAATTCTAAAAGGATAATTTTATTCGTTATCCTAAAGTAATTACATTGTTAATCTTGTTTGCTTTAGTTTTTTACATTATGAGTTTGTTTTCTTATTGTATATTAGTTTGGTTGTGTCTCATATGTACCATATTAATTAATTATGATAATAAATAAACATTGGAACGACTTTACAGA CAAATGTTCATCAAAGTTATATAAAAGAGCTACGAGAAATGGGAAGGCCAATTCTTGTCACCCATGGTGGTGCCTTTGGAGATGTCACCTTGTTCACTTCCAGGGCTTATTTTTGCTTTCAACCATCATTCTTTCCGTCTCTCTCATTTCGATGATCATATTTGCTTGTAGCGACTCTCATAAGAAAAAGAGAAGATATGGTGGTGGCGGCGGCGGTGGAGGTTGCGGGGGCGACGGTGGTGGAGGTGGTGGAGGTTGTGGCGGTGGCGGAGGAGGTGGGGGCTGTGGCGGCGGAGGTGGAGGTGGATGTTAAAGACATACATGTTTGGTCTCCCTTATATTTGTTTCATTAGAATTCTAAAAGGATAATTTTATTCGTTATCCTAAAGTAATTACATTGTTAATCTTGTTTGCTTTAGTTTTTTACATTATGAGTTTGTTTTCTTATTGTATATTAGTTTGGTTGTGTCTCATATGTACCATATTAATTAATTATGATAATAAATAAACATTGGAACGACTTTACAGA ATGATCATATTTGCTTGTAGCGACTCTCATAAGAAAAAGAGAAGATATGGTGGTGGCGGCGGCGGTGGAGGTTGCGGGGGCGACGGTGGTGGAGGTGGTGGAGGTTGTGGCGGTGGCGGAGGAGGTGGGGGCTGTGGCGGCGGAGGTGGAGGTGGATGTTAA MIIFACSDSHKKKRRYGGGGGGGGCGGDGGGGGGGCGGGGGGGGCGGGGGGGC*
BLAST of MELO3C013894 vs. Swiss-Prot
Match: LORI_MOUSE (Loricrin OS=Mus musculus GN=Lor PE=2 SV=2) HSP 1 Score: 67.8 bits (164), Expect = 4.2e-11 Identity = 34/51 (66.67%), Postives = 34/51 (66.67%), Query Frame = 1
HSP 2 Score: 65.9 bits (159), Expect = 1.6e-10 Identity = 28/39 (71.79%), Postives = 26/39 (66.67%), Query Frame = 1
HSP 3 Score: 64.3 bits (155), Expect = 4.6e-10 Identity = 29/38 (76.32%), Postives = 27/38 (71.05%), Query Frame = 1
HSP 4 Score: 63.5 bits (153), Expect = 7.9e-10 Identity = 27/39 (69.23%), Postives = 25/39 (64.10%), Query Frame = 1
HSP 5 Score: 63.2 bits (152), Expect = 1.0e-09 Identity = 28/37 (75.68%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 6 Score: 62.8 bits (151), Expect = 1.4e-09 Identity = 30/45 (66.67%), Postives = 29/45 (64.44%), Query Frame = 1
HSP 7 Score: 62.8 bits (151), Expect = 1.4e-09 Identity = 28/44 (63.64%), Postives = 26/44 (59.09%), Query Frame = 1
HSP 8 Score: 62.8 bits (151), Expect = 1.4e-09 Identity = 28/42 (66.67%), Postives = 26/42 (61.90%), Query Frame = 1
HSP 9 Score: 62.0 bits (149), Expect = 2.3e-09 Identity = 32/44 (72.73%), Postives = 30/44 (68.18%), Query Frame = 1
HSP 10 Score: 59.7 bits (143), Expect = 1.1e-08 Identity = 30/48 (62.50%), Postives = 28/48 (58.33%), Query Frame = 1
HSP 11 Score: 58.5 bits (140), Expect = 2.5e-08 Identity = 26/40 (65.00%), Postives = 24/40 (60.00%), Query Frame = 1
HSP 12 Score: 58.5 bits (140), Expect = 2.5e-08 Identity = 27/43 (62.79%), Postives = 25/43 (58.14%), Query Frame = 1
HSP 13 Score: 58.2 bits (139), Expect = 3.3e-08 Identity = 26/37 (70.27%), Postives = 24/37 (64.86%), Query Frame = 1
HSP 14 Score: 56.6 bits (135), Expect = 9.7e-08 Identity = 29/42 (69.05%), Postives = 27/42 (64.29%), Query Frame = 1
HSP 15 Score: 56.2 bits (134), Expect = 1.3e-07 Identity = 24/41 (58.54%), Postives = 22/41 (53.66%), Query Frame = 1
HSP 16 Score: 56.2 bits (134), Expect = 1.3e-07 Identity = 30/50 (60.00%), Postives = 28/50 (56.00%), Query Frame = 1
HSP 17 Score: 55.5 bits (132), Expect = 2.2e-07 Identity = 24/35 (68.57%), Postives = 22/35 (62.86%), Query Frame = 1
HSP 18 Score: 55.5 bits (132), Expect = 2.2e-07 Identity = 31/58 (53.45%), Postives = 31/58 (53.45%), Query Frame = 1
HSP 19 Score: 55.5 bits (132), Expect = 2.2e-07 Identity = 26/38 (68.42%), Postives = 24/38 (63.16%), Query Frame = 1
HSP 20 Score: 55.1 bits (131), Expect = 2.8e-07 Identity = 27/50 (54.00%), Postives = 25/50 (50.00%), Query Frame = 1
HSP 21 Score: 54.7 bits (130), Expect = 3.7e-07 Identity = 27/52 (51.92%), Postives = 25/52 (48.08%), Query Frame = 1
HSP 22 Score: 54.7 bits (130), Expect = 3.7e-07 Identity = 26/44 (59.09%), Postives = 24/44 (54.55%), Query Frame = 1
HSP 23 Score: 53.9 bits (128), Expect = 6.3e-07 Identity = 26/39 (66.67%), Postives = 24/39 (61.54%), Query Frame = 1
HSP 24 Score: 53.1 bits (126), Expect = 1.1e-06 Identity = 29/44 (65.91%), Postives = 27/44 (61.36%), Query Frame = 1
HSP 25 Score: 53.1 bits (126), Expect = 1.1e-06 Identity = 26/42 (61.90%), Postives = 24/42 (57.14%), Query Frame = 1
HSP 26 Score: 52.4 bits (124), Expect = 1.8e-06 Identity = 31/62 (50.00%), Postives = 29/62 (46.77%), Query Frame = 1
HSP 27 Score: 52.4 bits (124), Expect = 1.8e-06 Identity = 30/61 (49.18%), Postives = 28/61 (45.90%), Query Frame = 1
HSP 28 Score: 49.3 bits (116), Expect = 1.5e-05 Identity = 27/43 (62.79%), Postives = 25/43 (58.14%), Query Frame = 1
HSP 29 Score: 48.5 bits (114), Expect = 2.6e-05 Identity = 22/36 (61.11%), Postives = 20/36 (55.56%), Query Frame = 1
BLAST of MELO3C013894 vs. Swiss-Prot
Match: LRCH2_MOUSE (Leucine-rich repeat and calponin homology domain-containing protein 2 OS=Mus musculus GN=Lrch2 PE=2 SV=2) HSP 1 Score: 66.6 bits (161), Expect = 9.4e-11 Identity = 31/43 (72.09%), Postives = 29/43 (67.44%), Query Frame = 1
BLAST of MELO3C013894 vs. Swiss-Prot
Match: GAR1_DROME (Probable H/ACA ribonucleoprotein complex subunit 1 OS=Drosophila melanogaster GN=CG4038 PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 2.7e-10 Identity = 30/40 (75.00%), Postives = 28/40 (70.00%), Query Frame = 1
HSP 2 Score: 60.8 bits (146), Expect = 5.1e-09 Identity = 29/39 (74.36%), Postives = 28/39 (71.79%), Query Frame = 1
HSP 3 Score: 59.7 bits (143), Expect = 1.1e-08 Identity = 31/45 (68.89%), Postives = 29/45 (64.44%), Query Frame = 1
HSP 4 Score: 56.6 bits (135), Expect = 9.7e-08 Identity = 30/47 (63.83%), Postives = 28/47 (59.57%), Query Frame = 1
HSP 5 Score: 54.3 bits (129), Expect = 4.8e-07 Identity = 28/45 (62.22%), Postives = 27/45 (60.00%), Query Frame = 1
HSP 6 Score: 52.4 bits (124), Expect = 1.8e-06 Identity = 24/39 (61.54%), Postives = 24/39 (61.54%), Query Frame = 1
HSP 7 Score: 52.0 bits (123), Expect = 2.4e-06 Identity = 24/36 (66.67%), Postives = 23/36 (63.89%), Query Frame = 1
HSP 8 Score: 38.9 bits (89), Expect = 2.1e-02 Identity = 18/26 (69.23%), Postives = 16/26 (61.54%), Query Frame = 1
BLAST of MELO3C013894 vs. Swiss-Prot
Match: ZXDB_MOUSE (Zinc finger X-linked protein ZXDB OS=Mus musculus GN=Zxdb PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 3.6e-10 Identity = 28/36 (77.78%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 2 Score: 61.6 bits (148), Expect = 3.0e-09 Identity = 27/36 (75.00%), Postives = 25/36 (69.44%), Query Frame = 1
HSP 3 Score: 60.8 bits (146), Expect = 5.1e-09 Identity = 27/41 (65.85%), Postives = 26/41 (63.41%), Query Frame = 1
BLAST of MELO3C013894 vs. Swiss-Prot
Match: SRSF1_XENTR (Serine/arginine-rich splicing factor 1 OS=Xenopus tropicalis GN=srsf1 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 3.6e-10 Identity = 28/34 (82.35%), Postives = 26/34 (76.47%), Query Frame = 1
HSP 2 Score: 62.8 bits (151), Expect = 1.4e-09 Identity = 28/36 (77.78%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 3 Score: 61.6 bits (148), Expect = 3.0e-09 Identity = 27/45 (60.00%), Postives = 29/45 (64.44%), Query Frame = 1
HSP 4 Score: 60.8 bits (146), Expect = 5.1e-09 Identity = 27/36 (75.00%), Postives = 25/36 (69.44%), Query Frame = 1
BLAST of MELO3C013894 vs. TrEMBL
Match: A0A0N4W304_HAEPC (Uncharacterized protein OS=Haemonchus placei PE=4 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 9.1e-13 Identity = 34/39 (87.18%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MELO3C013894 vs. TrEMBL
Match: A0A0N4W304_HAEPC (Uncharacterized protein OS=Haemonchus placei PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 4.5e-12 Identity = 33/38 (86.84%), Postives = 33/38 (86.84%), Query Frame = 1
HSP 2 Score: 77.4 bits (189), Expect = 5.9e-12 Identity = 34/46 (73.91%), Postives = 34/46 (73.91%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 6 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 7 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 8 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 9 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 36/53 (67.92%), Postives = 37/53 (69.81%), Query Frame = 1
HSP 10 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 11 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 12 Score: 72.0 bits (175), Expect = 2.5e-10 Identity = 32/42 (76.19%), Postives = 32/42 (76.19%), Query Frame = 1
HSP 13 Score: 70.9 bits (172), Expect = 5.5e-10 Identity = 33/43 (76.74%), Postives = 33/43 (76.74%), Query Frame = 1
HSP 14 Score: 68.2 bits (165), Expect = 3.6e-09 Identity = 35/57 (61.40%), Postives = 35/57 (61.40%), Query Frame = 1
HSP 15 Score: 67.4 bits (163), Expect = 6.1e-09 Identity = 32/39 (82.05%), Postives = 32/39 (82.05%), Query Frame = 1
HSP 16 Score: 67.0 bits (162), Expect = 8.0e-09 Identity = 35/49 (71.43%), Postives = 35/49 (71.43%), Query Frame = 1
HSP 17 Score: 67.0 bits (162), Expect = 8.0e-09 Identity = 35/49 (71.43%), Postives = 35/49 (71.43%), Query Frame = 1
HSP 18 Score: 67.0 bits (162), Expect = 8.0e-09 Identity = 35/49 (71.43%), Postives = 35/49 (71.43%), Query Frame = 1
HSP 19 Score: 67.0 bits (162), Expect = 8.0e-09 Identity = 35/49 (71.43%), Postives = 35/49 (71.43%), Query Frame = 1
HSP 20 Score: 65.5 bits (158), Expect = 2.3e-08 Identity = 35/53 (66.04%), Postives = 35/53 (66.04%), Query Frame = 1
HSP 21 Score: 64.7 bits (156), Expect = 4.0e-08 Identity = 34/48 (70.83%), Postives = 34/48 (70.83%), Query Frame = 1
HSP 22 Score: 80.1 bits (196), Expect = 9.1e-13 Identity = 34/39 (87.18%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MELO3C013894 vs. TrEMBL
Match: U6PU01_HAECO (Protein GRL-25 OS=Haemonchus contortus GN=HCOI_02112300 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 5.9e-12 Identity = 34/46 (73.91%), Postives = 34/46 (73.91%), Query Frame = 1
HSP 2 Score: 76.6 bits (187), Expect = 1.0e-11 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 3 Score: 76.6 bits (187), Expect = 1.0e-11 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 6 Score: 72.8 bits (177), Expect = 1.5e-10 Identity = 35/45 (77.78%), Postives = 35/45 (77.78%), Query Frame = 1
HSP 7 Score: 72.4 bits (176), Expect = 1.9e-10 Identity = 33/41 (80.49%), Postives = 33/41 (80.49%), Query Frame = 1
HSP 8 Score: 72.0 bits (175), Expect = 2.5e-10 Identity = 32/42 (76.19%), Postives = 32/42 (76.19%), Query Frame = 1
HSP 9 Score: 71.6 bits (174), Expect = 3.2e-10 Identity = 34/50 (68.00%), Postives = 34/50 (68.00%), Query Frame = 1
HSP 10 Score: 71.2 bits (173), Expect = 4.2e-10 Identity = 31/37 (83.78%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 11 Score: 67.4 bits (163), Expect = 6.1e-09 Identity = 32/39 (82.05%), Postives = 32/39 (82.05%), Query Frame = 1
HSP 12 Score: 66.6 bits (161), Expect = 1.0e-08 Identity = 33/45 (73.33%), Postives = 33/45 (73.33%), Query Frame = 1
HSP 13 Score: 65.9 bits (159), Expect = 1.8e-08 Identity = 34/56 (60.71%), Postives = 34/56 (60.71%), Query Frame = 1
HSP 14 Score: 79.7 bits (195), Expect = 1.2e-12 Identity = 34/40 (85.00%), Postives = 34/40 (85.00%), Query Frame = 1
BLAST of MELO3C013894 vs. TrEMBL
Match: Q0C9U0_ASPTN (Uncharacterized protein OS=Aspergillus terreus (strain NIH 2624 / FGSC A1156) GN=ATEG_09544 PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 2.7e-09 Identity = 29/37 (78.38%), Postives = 29/37 (78.38%), Query Frame = 1
HSP 2 Score: 65.1 bits (157), Expect = 3.0e-08 Identity = 33/51 (64.71%), Postives = 33/51 (64.71%), Query Frame = 1
HSP 3 Score: 60.5 bits (145), Expect = 7.5e-07 Identity = 25/36 (69.44%), Postives = 25/36 (69.44%), Query Frame = 1
HSP 4 Score: 46.6 bits (109), Expect = 1.1e-02 Identity = 24/47 (51.06%), Postives = 24/47 (51.06%), Query Frame = 1
HSP 5 Score: 79.3 bits (194), Expect = 1.6e-12 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of MELO3C013894 vs. TrEMBL
Match: J3LVY5_ORYBR (Uncharacterized protein OS=Oryza brachyantha PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 2 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 6 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 7 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 8 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 9 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 10 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 11 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 12 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 13 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 14 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 15 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 16 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 17 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 18 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 19 Score: 74.7 bits (182), Expect = 3.8e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 20 Score: 61.6 bits (148), Expect = 3.3e-07 Identity = 27/36 (75.00%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 21 Score: 52.0 bits (123), Expect = 2.7e-04 Identity = 23/37 (62.16%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 22 Score: 43.1 bits (100), Expect = 1.2e-01 Identity = 19/27 (70.37%), Postives = 20/27 (74.07%), Query Frame = 1
HSP 23 Score: 35.0 bits (79), Expect = 3.4e+01 Identity = 16/25 (64.00%), Postives = 16/25 (64.00%), Query Frame = 1
HSP 24 Score: 79.3 bits (194), Expect = 1.6e-12 Identity = 35/44 (79.55%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of MELO3C013894 vs. TAIR10
Match: AT4G36230.1 (AT4G36230.1 unknown protein) HSP 1 Score: 74.3 bits (181), Expect = 2.5e-14 Identity = 35/54 (64.81%), Postives = 36/54 (66.67%), Query Frame = 1
HSP 2 Score: 68.2 bits (165), Expect = 1.8e-12 Identity = 30/37 (81.08%), Postives = 28/37 (75.68%), Query Frame = 1
HSP 3 Score: 65.9 bits (159), Expect = 9.0e-12 Identity = 33/63 (52.38%), Postives = 34/63 (53.97%), Query Frame = 1
HSP 4 Score: 63.2 bits (152), Expect = 5.8e-11 Identity = 28/36 (77.78%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 5 Score: 60.8 bits (146), Expect = 2.9e-10 Identity = 30/49 (61.22%), Postives = 28/49 (57.14%), Query Frame = 1
HSP 6 Score: 60.5 bits (145), Expect = 3.8e-10 Identity = 32/62 (51.61%), Postives = 32/62 (51.61%), Query Frame = 1
HSP 7 Score: 58.2 bits (139), Expect = 1.9e-09 Identity = 26/35 (74.29%), Postives = 24/35 (68.57%), Query Frame = 1
HSP 8 Score: 55.5 bits (132), Expect = 1.2e-08 Identity = 27/39 (69.23%), Postives = 25/39 (64.10%), Query Frame = 1
HSP 9 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 25/48 (52.08%), Postives = 24/48 (50.00%), Query Frame = 1
HSP 10 Score: 50.8 bits (120), Expect = 3.0e-07 Identity = 30/58 (51.72%), Postives = 29/58 (50.00%), Query Frame = 1
BLAST of MELO3C013894 vs. TAIR10
Match: AT1G75550.1 (AT1G75550.1 glycine-rich protein) HSP 1 Score: 68.2 bits (165), Expect = 1.8e-12 Identity = 31/38 (81.58%), Postives = 30/38 (78.95%), Query Frame = 1
HSP 2 Score: 67.0 bits (162), Expect = 4.0e-12 Identity = 34/49 (69.39%), Postives = 32/49 (65.31%), Query Frame = 1
HSP 3 Score: 65.1 bits (157), Expect = 1.5e-11 Identity = 30/40 (75.00%), Postives = 28/40 (70.00%), Query Frame = 1
HSP 4 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 25/38 (65.79%), Postives = 23/38 (60.53%), Query Frame = 1
BLAST of MELO3C013894 vs. TAIR10
Match: AT3G23450.1 (AT3G23450.1 unknown protein) HSP 1 Score: 66.2 bits (160), Expect = 6.9e-12 Identity = 29/36 (80.56%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 2 Score: 63.9 bits (154), Expect = 3.4e-11 Identity = 28/37 (75.68%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 3 Score: 63.5 bits (153), Expect = 4.5e-11 Identity = 28/35 (80.00%), Postives = 26/35 (74.29%), Query Frame = 1
HSP 4 Score: 63.5 bits (153), Expect = 4.5e-11 Identity = 30/37 (81.08%), Postives = 28/37 (75.68%), Query Frame = 1
HSP 5 Score: 63.2 bits (152), Expect = 5.8e-11 Identity = 28/35 (80.00%), Postives = 26/35 (74.29%), Query Frame = 1
HSP 6 Score: 62.0 bits (149), Expect = 1.3e-10 Identity = 28/36 (77.78%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 7 Score: 62.0 bits (149), Expect = 1.3e-10 Identity = 28/37 (75.68%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 8 Score: 62.0 bits (149), Expect = 1.3e-10 Identity = 29/40 (72.50%), Postives = 28/40 (70.00%), Query Frame = 1
HSP 9 Score: 61.6 bits (148), Expect = 1.7e-10 Identity = 28/36 (77.78%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 10 Score: 61.6 bits (148), Expect = 1.7e-10 Identity = 27/37 (72.97%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 11 Score: 60.5 bits (145), Expect = 3.8e-10 Identity = 29/37 (78.38%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 12 Score: 59.7 bits (143), Expect = 6.4e-10 Identity = 29/42 (69.05%), Postives = 27/42 (64.29%), Query Frame = 1
HSP 13 Score: 58.9 bits (141), Expect = 1.1e-09 Identity = 31/43 (72.09%), Postives = 30/43 (69.77%), Query Frame = 1
HSP 14 Score: 57.8 bits (138), Expect = 2.4e-09 Identity = 29/48 (60.42%), Postives = 28/48 (58.33%), Query Frame = 1
HSP 15 Score: 57.0 bits (136), Expect = 4.2e-09 Identity = 30/43 (69.77%), Postives = 28/43 (65.12%), Query Frame = 1
HSP 16 Score: 57.0 bits (136), Expect = 4.2e-09 Identity = 29/50 (58.00%), Postives = 27/50 (54.00%), Query Frame = 1
HSP 17 Score: 54.3 bits (129), Expect = 2.7e-08 Identity = 29/45 (64.44%), Postives = 27/45 (60.00%), Query Frame = 1
HSP 18 Score: 53.5 bits (127), Expect = 4.6e-08 Identity = 28/38 (73.68%), Postives = 26/38 (68.42%), Query Frame = 1
HSP 19 Score: 52.8 bits (125), Expect = 7.9e-08 Identity = 25/36 (69.44%), Postives = 23/36 (63.89%), Query Frame = 1
HSP 20 Score: 52.8 bits (125), Expect = 7.9e-08 Identity = 28/42 (66.67%), Postives = 27/42 (64.29%), Query Frame = 1
HSP 21 Score: 52.4 bits (124), Expect = 1.0e-07 Identity = 27/43 (62.79%), Postives = 25/43 (58.14%), Query Frame = 1
HSP 22 Score: 52.4 bits (124), Expect = 1.0e-07 Identity = 26/38 (68.42%), Postives = 25/38 (65.79%), Query Frame = 1
HSP 23 Score: 52.4 bits (124), Expect = 1.0e-07 Identity = 29/47 (61.70%), Postives = 27/47 (57.45%), Query Frame = 1
HSP 24 Score: 52.4 bits (124), Expect = 1.0e-07 Identity = 32/59 (54.24%), Postives = 31/59 (52.54%), Query Frame = 1
HSP 25 Score: 52.0 bits (123), Expect = 1.3e-07 Identity = 26/38 (68.42%), Postives = 25/38 (65.79%), Query Frame = 1
HSP 26 Score: 52.0 bits (123), Expect = 1.3e-07 Identity = 28/43 (65.12%), Postives = 26/43 (60.47%), Query Frame = 1
HSP 27 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 25/36 (69.44%), Postives = 23/36 (63.89%), Query Frame = 1
HSP 28 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 26/38 (68.42%), Postives = 25/38 (65.79%), Query Frame = 1
HSP 29 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 27/43 (62.79%), Postives = 25/43 (58.14%), Query Frame = 1
HSP 30 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 27/38 (71.05%), Postives = 25/38 (65.79%), Query Frame = 1
HSP 31 Score: 50.8 bits (120), Expect = 3.0e-07 Identity = 27/41 (65.85%), Postives = 25/41 (60.98%), Query Frame = 1
HSP 32 Score: 50.8 bits (120), Expect = 3.0e-07 Identity = 28/40 (70.00%), Postives = 26/40 (65.00%), Query Frame = 1
HSP 33 Score: 49.7 bits (117), Expect = 6.7e-07 Identity = 27/39 (69.23%), Postives = 25/39 (64.10%), Query Frame = 1
HSP 34 Score: 49.7 bits (117), Expect = 6.7e-07 Identity = 28/44 (63.64%), Postives = 27/44 (61.36%), Query Frame = 1
HSP 35 Score: 49.3 bits (116), Expect = 8.7e-07 Identity = 27/43 (62.79%), Postives = 25/43 (58.14%), Query Frame = 1
HSP 36 Score: 48.9 bits (115), Expect = 1.1e-06 Identity = 25/38 (65.79%), Postives = 24/38 (63.16%), Query Frame = 1
HSP 37 Score: 48.5 bits (114), Expect = 1.5e-06 Identity = 25/38 (65.79%), Postives = 24/38 (63.16%), Query Frame = 1
HSP 38 Score: 48.5 bits (114), Expect = 1.5e-06 Identity = 25/38 (65.79%), Postives = 24/38 (63.16%), Query Frame = 1
HSP 39 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 40 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 41 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 26/37 (70.27%), Postives = 24/37 (64.86%), Query Frame = 1
HSP 42 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 27/40 (67.50%), Postives = 25/40 (62.50%), Query Frame = 1
HSP 43 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 26/38 (68.42%), Postives = 24/38 (63.16%), Query Frame = 1
HSP 44 Score: 48.1 bits (113), Expect = 1.9e-06 Identity = 30/49 (61.22%), Postives = 28/49 (57.14%), Query Frame = 1
HSP 45 Score: 47.8 bits (112), Expect = 2.5e-06 Identity = 26/39 (66.67%), Postives = 24/39 (61.54%), Query Frame = 1
HSP 46 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 47 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 48 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 49 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 50 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 51 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 26/41 (63.41%), Postives = 24/41 (58.54%), Query Frame = 1
HSP 52 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 53 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 54 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 55 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 56 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 57 Score: 47.0 bits (110), Expect = 4.3e-06 Identity = 25/37 (67.57%), Postives = 23/37 (62.16%), Query Frame = 1
HSP 58 Score: 46.6 bits (109), Expect = 5.6e-06 Identity = 28/49 (57.14%), Postives = 26/49 (53.06%), Query Frame = 1
HSP 59 Score: 46.6 bits (109), Expect = 5.6e-06 Identity = 28/47 (59.57%), Postives = 26/47 (55.32%), Query Frame = 1
HSP 60 Score: 45.8 bits (107), Expect = 9.6e-06 Identity = 27/49 (55.10%), Postives = 25/49 (51.02%), Query Frame = 1
BLAST of MELO3C013894 vs. TAIR10
Match: AT4G13850.1 (AT4G13850.1 glycine-rich RNA-binding protein 2) HSP 1 Score: 64.7 bits (156), Expect = 2.0e-11 Identity = 30/46 (65.22%), Postives = 29/46 (63.04%), Query Frame = 1
BLAST of MELO3C013894 vs. TAIR10
Match: AT4G38680.1 (AT4G38680.1 glycine rich protein 2) HSP 1 Score: 62.4 bits (150), Expect = 9.9e-11 Identity = 30/37 (81.08%), Postives = 28/37 (75.68%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 3.8e-10 Identity = 30/52 (57.69%), Postives = 30/52 (57.69%), Query Frame = 1
HSP 3 Score: 55.1 bits (131), Expect = 1.6e-08 Identity = 28/42 (66.67%), Postives = 26/42 (61.90%), Query Frame = 1
HSP 4 Score: 53.1 bits (126), Expect = 6.0e-08 Identity = 26/39 (66.67%), Postives = 24/39 (61.54%), Query Frame = 1
HSP 5 Score: 51.2 bits (121), Expect = 2.3e-07 Identity = 28/48 (58.33%), Postives = 26/48 (54.17%), Query Frame = 1
HSP 6 Score: 47.4 bits (111), Expect = 3.3e-06 Identity = 28/57 (49.12%), Postives = 26/57 (45.61%), Query Frame = 1
HSP 7 Score: 34.3 bits (77), Expect = 2.9e-02 Identity = 21/51 (41.18%), Postives = 23/51 (45.10%), Query Frame = 1
BLAST of MELO3C013894 vs. NCBI nr
Match: gi|560117928|emb|CDJ97445.1| (Protein GRL-25 [Haemonchus contortus]) HSP 1 Score: 80.1 bits (196), Expect = 1.3e-12 Identity = 34/39 (87.18%), Postives = 34/39 (87.18%), Query Frame = 1
BLAST of MELO3C013894 vs. NCBI nr
Match: gi|560117928|emb|CDJ97445.1| (Protein GRL-25 [Haemonchus contortus]) HSP 1 Score: 77.4 bits (189), Expect = 8.5e-12 Identity = 34/46 (73.91%), Postives = 34/46 (73.91%), Query Frame = 1
HSP 2 Score: 76.6 bits (187), Expect = 1.4e-11 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 3 Score: 76.6 bits (187), Expect = 1.4e-11 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 34/42 (80.95%), Postives = 34/42 (80.95%), Query Frame = 1
HSP 6 Score: 72.8 bits (177), Expect = 2.1e-10 Identity = 35/45 (77.78%), Postives = 35/45 (77.78%), Query Frame = 1
HSP 7 Score: 72.4 bits (176), Expect = 2.7e-10 Identity = 33/41 (80.49%), Postives = 33/41 (80.49%), Query Frame = 1
HSP 8 Score: 72.0 bits (175), Expect = 3.6e-10 Identity = 32/42 (76.19%), Postives = 32/42 (76.19%), Query Frame = 1
HSP 9 Score: 71.6 bits (174), Expect = 4.6e-10 Identity = 34/50 (68.00%), Postives = 34/50 (68.00%), Query Frame = 1
HSP 10 Score: 71.2 bits (173), Expect = 6.1e-10 Identity = 31/37 (83.78%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 11 Score: 67.4 bits (163), Expect = 8.8e-09 Identity = 32/39 (82.05%), Postives = 32/39 (82.05%), Query Frame = 1
HSP 12 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 33/45 (73.33%), Postives = 33/45 (73.33%), Query Frame = 1
HSP 13 Score: 65.9 bits (159), Expect = 2.5e-08 Identity = 34/56 (60.71%), Postives = 34/56 (60.71%), Query Frame = 1
HSP 14 Score: 79.3 bits (194), Expect = 2.2e-12 Identity = 35/44 (79.55%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of MELO3C013894 vs. NCBI nr
Match: gi|241655477|ref|XP_002411386.1| (conserved hypothetical protein [Ixodes scapularis]) HSP 1 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 2 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 6 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 7 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 8 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 9 Score: 69.3 bits (168), Expect = 2.3e-09 Identity = 32/46 (69.57%), Postives = 32/46 (69.57%), Query Frame = 1
HSP 10 Score: 38.9 bits (89), Expect = 3.3e+00 Identity = 16/21 (76.19%), Postives = 16/21 (76.19%), Query Frame = 1
HSP 11 Score: 38.1 bits (87), Expect = 5.7e+00 Identity = 15/17 (88.24%), Postives = 15/17 (88.24%), Query Frame = 1
HSP 12 Score: 36.2 bits (82), Expect = 2.2e+01 Identity = 15/21 (71.43%), Postives = 15/21 (71.43%), Query Frame = 1
HSP 13 Score: 35.4 bits (80), Expect = 3.7e+01 Identity = 15/24 (62.50%), Postives = 15/24 (62.50%), Query Frame = 1
HSP 14 Score: 79.3 bits (194), Expect = 2.2e-12 Identity = 33/36 (91.67%), Postives = 33/36 (91.67%), Query Frame = 1
BLAST of MELO3C013894 vs. NCBI nr
Match: gi|817011986|gb|KKO21286.1| (hypothetical protein XA41_25785, partial [Escherichia coli]) HSP 1 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 2 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 6 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 7 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 8 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 9 Score: 73.2 bits (178), Expect = 1.6e-10 Identity = 33/41 (80.49%), Postives = 33/41 (80.49%), Query Frame = 1
HSP 10 Score: 79.3 bits (194), Expect = 2.2e-12 Identity = 33/36 (91.67%), Postives = 33/36 (91.67%), Query Frame = 1
BLAST of MELO3C013894 vs. NCBI nr
Match: gi|551627805|ref|XP_005793883.1| (hypothetical protein EMIHUDRAFT_94738 [Emiliania huxleyi CCMP1516]) HSP 1 Score: 78.2 bits (191), Expect = 5.0e-12 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
HSP 2 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 5 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 6 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 7 Score: 74.7 bits (182), Expect = 5.5e-11 Identity = 32/36 (88.89%), Postives = 32/36 (88.89%), Query Frame = 1
HSP 8 Score: 73.2 bits (178), Expect = 1.6e-10 Identity = 33/41 (80.49%), Postives = 33/41 (80.49%), Query Frame = 1
HSP 9 Score: 71.2 bits (173), Expect = 6.1e-10 Identity = 31/36 (86.11%), Postives = 31/36 (86.11%), Query Frame = 1
HSP 10 Score: 71.2 bits (173), Expect = 6.1e-10 Identity = 30/35 (85.71%), Postives = 30/35 (85.71%), Query Frame = 1
HSP 11 Score: 63.9 bits (154), Expect = 9.7e-08 Identity = 28/36 (77.78%), Postives = 28/36 (77.78%), Query Frame = 1
HSP 12 Score: 59.7 bits (143), Expect = 1.8e-06 Identity = 27/36 (75.00%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 13 Score: 57.8 bits (138), Expect = 6.9e-06 Identity = 25/36 (69.44%), Postives = 25/36 (69.44%), Query Frame = 1
HSP 14 Score: 52.4 bits (124), Expect = 2.9e-04 Identity = 24/36 (66.67%), Postives = 24/36 (66.67%), Query Frame = 1
HSP 15 Score: 50.1 bits (118), Expect = 1.4e-03 Identity = 22/36 (61.11%), Postives = 22/36 (61.11%), Query Frame = 1
HSP 16 Score: 47.0 bits (110), Expect = 1.2e-02 Identity = 23/39 (58.97%), Postives = 23/39 (58.97%), Query Frame = 1
HSP 17 Score: 45.4 bits (106), Expect = 3.6e-02 Identity = 22/39 (56.41%), Postives = 22/39 (56.41%), Query Frame = 1
HSP 18 Score: 43.9 bits (102), Expect = 1.0e-01 Identity = 21/36 (58.33%), Postives = 21/36 (58.33%), Query Frame = 1
HSP 19 Score: 42.4 bits (98), Expect = 3.0e-01 Identity = 26/52 (50.00%), Postives = 27/52 (51.92%), Query Frame = 1
HSP 20 Score: 78.2 bits (191), Expect = 5.0e-12 Identity = 33/37 (89.19%), Postives = 33/37 (89.19%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |