MELO3C013035 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA ATGGAGATTCTACGCAGTCAGAAATTGATACAGAAAAGGGGTTCGACAGGAAAGTCCTTTCAATCCAATCCATTCTTGAAGTCCAATAAAGACAAAGGATATGTCAGTGACCTAGCACGAGAAAGCACTCTCCGAAGGCATGAAATGTCCAATTTTTTTCTTCAAAATCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCTGGCCGAAATATATAA MEILRSQKLIQKRGSTGKSFQSNPFLKSNKDKGYVSDLARESTLRRHEMSNFFLQNHYRNSNVFLKFSGRNI*
BLAST of MELO3C013035 vs. Swiss-Prot
Match: RM05_OENBE (60S ribosomal protein L5, mitochondrial OS=Oenothera berteroana GN=RPL5 PE=2 SV=2) HSP 1 Score: 84.7 bits (208), Expect = 4.5e-16 Identity = 43/56 (76.79%), Postives = 47/56 (83.93%), Query Frame = 1
BLAST of MELO3C013035 vs. Swiss-Prot
Match: RM05_BRANA (60S ribosomal protein L5, mitochondrial OS=Brassica napus GN=RPL5 PE=3 SV=2) HSP 1 Score: 82.4 bits (202), Expect = 2.2e-15 Identity = 43/53 (81.13%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of MELO3C013035 vs. Swiss-Prot
Match: RM05_ARATH (60S ribosomal protein L5, mitochondrial OS=Arabidopsis thaliana GN=RPL5 PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.1e-14 Identity = 42/56 (75.00%), Postives = 45/56 (80.36%), Query Frame = 1
BLAST of MELO3C013035 vs. Swiss-Prot
Match: RM05_SOLTU (60S ribosomal protein L5, mitochondrial OS=Solanum tuberosum GN=RPL5 PE=2 SV=2) HSP 1 Score: 62.8 bits (151), Expect = 1.8e-09 Identity = 37/56 (66.07%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of MELO3C013035 vs. Swiss-Prot
Match: RM05_MARPO (60S ribosomal protein L5, mitochondrial OS=Marchantia polymorpha GN=RPL5 PE=3 SV=2) HSP 1 Score: 50.8 bits (120), Expect = 7.2e-06 Identity = 33/57 (57.89%), Postives = 37/57 (64.91%), Query Frame = 1
BLAST of MELO3C013035 vs. TrEMBL
Match: G3EU44_CUCME (Ribosomal protein L5 OS=Cucumis melo subsp. melo GN=rpl5 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 2.8e-17 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 1
BLAST of MELO3C013035 vs. TrEMBL
Match: G3EIZ3_CUCSA (Ribosomal protein L5 OS=Cucumis sativus GN=rpl5 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.1e-16 Identity = 45/55 (81.82%), Postives = 49/55 (89.09%), Query Frame = 1
BLAST of MELO3C013035 vs. TrEMBL
Match: Q7Y6H0_CUCSA (Ribosomal protein L5 OS=Cucumis sativus GN=rpl5 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.6e-15 Identity = 44/55 (80.00%), Postives = 48/55 (87.27%), Query Frame = 1
BLAST of MELO3C013035 vs. TrEMBL
Match: K7Z325_LAGSI (Ribosomal protein L5 (Fragment) OS=Lagenaria siceraria PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.1e-13 Identity = 43/53 (81.13%), Postives = 47/53 (88.68%), Query Frame = 1
BLAST of MELO3C013035 vs. TrEMBL
Match: D5I3H1_CUCPE (Ribosomal protein L5 OS=Cucurbita pepo GN=rpl5 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 1.9e-13 Identity = 43/56 (76.79%), Postives = 49/56 (87.50%), Query Frame = 1
BLAST of MELO3C013035 vs. TAIR10
Match: AT2G07725.1 (AT2G07725.1 Ribosomal L5P family protein) HSP 1 Score: 82.4 bits (202), Expect = 1.3e-16 Identity = 43/53 (81.13%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of MELO3C013035 vs. TAIR10
Match: ATMG00210.1 (ATMG00210.1 ribosomal protein L5) HSP 1 Score: 82.4 bits (202), Expect = 1.3e-16 Identity = 43/53 (81.13%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of MELO3C013035 vs. NCBI nr
Match: gi|345034450|gb|AEN56134.1| (ribosomal protein L5 [Cucumis melo subsp. melo]) HSP 1 Score: 95.5 bits (236), Expect = 4.1e-17 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = 1
BLAST of MELO3C013035 vs. NCBI nr
Match: gi|346683379|ref|YP_004849341.1| (ribosomal protein L5 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 4.5e-16 Identity = 45/55 (81.82%), Postives = 49/55 (89.09%), Query Frame = 1
BLAST of MELO3C013035 vs. NCBI nr
Match: gi|31322683|gb|AAP33159.1| (ribosomal protein L5 [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 3.8e-15 Identity = 44/55 (80.00%), Postives = 48/55 (87.27%), Query Frame = 1
BLAST of MELO3C013035 vs. NCBI nr
Match: gi|730588|sp|Q05492.2|RM05_OENBE (RecName: Full=60S ribosomal protein L5, mitochondrial) HSP 1 Score: 84.7 bits (208), Expect = 7.2e-14 Identity = 43/56 (76.79%), Postives = 49/56 (87.50%), Query Frame = 1
BLAST of MELO3C013035 vs. NCBI nr
Match: gi|14029|emb|CAA49284.1| (ribosomal protein L5 (mitochondrion) [Oenothera berteroana]) HSP 1 Score: 84.0 bits (206), Expect = 1.2e-13 Identity = 43/53 (81.13%), Postives = 47/53 (88.68%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |