MELO3C011914 (gene) Melon (DHL92) v3.5.1

NameMELO3C011914
Typegene
OrganismCucumis melo (Melon (DHL92) v3.5.1)
DescriptionTransient receptor potential cation channel subfamily M member 1
Locationchr10 : 3938524 .. 3938769 (-)
The following sequences are available for this feature:

Gene sequence (with intron)

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
ATGAAGACGATTGTCGTTGTCGATGTTGAAGGTGATATCGAGATTCTGGATATGGGAGTGGACCTGCAACTGAGATCCGGAATAAGGTTGAAGAGAGAGGATCATGGCCATCAAAGGCGCGATAGAAGAAGAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAGATGGTTGAGGTTGACGGAGCAGTGGTAGACTTGGATCGCAAGCGAAAGGAGCGACTCAACGAACGGAAGCTTGATGGGTTGTAA

mRNA sequence

ATGAAGACGATTGTCGTTGTCGATGTTGAAGGTGATATCGAGATTCTGGATATGGGAGTGGACCTGCAACTGAGATCCGGAATAAGGTTGAAGAGAGAGGATCATGGCCATCAAAGGCGCGATAGAAGAAGAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAGATGGTTGAGGTTGACGGAGCAGTGGTAGACTTGGATCGCAAGCGAAAGGAGCGACTCAACGAACGGAAGCTTGATGGGTTGTAA

Coding sequence (CDS)

ATGAAGACGATTGTCGTTGTCGATGTTGAAGGTGATATCGAGATTCTGGATATGGGAGTGGACCTGCAACTGAGATCCGGAATAAGGTTGAAGAGAGAGGATCATGGCCATCAAAGGCGCGATAGAAGAAGAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAGATGGTTGAGGTTGACGGAGCAGTGGTAGACTTGGATCGCAAGCGAAAGGAGCGACTCAACGAACGGAAGCTTGATGGGTTGTAA

Protein sequence

MKTIVVVDVEGDIEILDMGVDLQLRSGIRLKREDHGHQRRDRRREEEEEEEEEKMVEVDGAVVDLDRKRKERLNERKLDGL*
GO Assignments
This gene is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0008150 biological_process
cellular_component GO:0005575 cellular_component
molecular_function GO:0003674 molecular_function
This gene is associated with the following unigenes:
Unigene NameAnalysis NameSequence type in Unigene
MU58863melon EST collection version 4.0transcribed_cluster

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameType
MELO3C011914T1MELO3C011914T1mRNA


The following transcribed_cluster feature(s) are associated with this gene:

Feature NameUnique NameType
MU58863MU58863transcribed_cluster


The following gene(s) are orthologous to this gene:

None

The following gene(s) are paralogous to this gene:

None

The following block(s) are covering this gene:
GeneOrganismBlock
MELO3C011914Bottle gourd (USVL1VR-Ls)lsimeB281
MELO3C011914Bottle gourd (USVL1VR-Ls)lsimeB462
MELO3C011914Cucumber (Gy14) v2cgybmeB077
MELO3C011914Cucumber (Gy14) v2cgybmeB319
MELO3C011914Silver-seed gourdcarmeB0246
MELO3C011914Silver-seed gourdcarmeB0505
MELO3C011914Silver-seed gourdcarmeB0623
MELO3C011914Silver-seed gourdcarmeB1039
MELO3C011914Cucumber (Chinese Long) v3cucmeB096
MELO3C011914Cucumber (Chinese Long) v3cucmeB381
MELO3C011914Watermelon (97103) v2mewmbB060
MELO3C011914Watermelon (97103) v2mewmbB072
MELO3C011914Wax gourdmewgoB063
MELO3C011914Wax gourdmewgoB072
MELO3C011914Melon (DHL92) v3.5.1memeB029
MELO3C011914Cucumber (Gy14) v1cgymeB077
MELO3C011914Cucumber (Gy14) v1cgymeB643
MELO3C011914Cucurbita maxima (Rimu)cmameB147
MELO3C011914Cucurbita maxima (Rimu)cmameB354
MELO3C011914Cucurbita maxima (Rimu)cmameB641
MELO3C011914Cucurbita maxima (Rimu)cmameB717
MELO3C011914Cucurbita moschata (Rifu)cmomeB137
MELO3C011914Cucurbita moschata (Rifu)cmomeB347
MELO3C011914Cucurbita moschata (Rifu)cmomeB632
MELO3C011914Cucurbita moschata (Rifu)cmomeB707
MELO3C011914Wild cucumber (PI 183967)cpimeB089
MELO3C011914Wild cucumber (PI 183967)cpimeB369
MELO3C011914Cucumber (Chinese Long) v2cumeB091
MELO3C011914Cucumber (Chinese Long) v2cumeB377
MELO3C011914Watermelon (Charleston Gray)mewcgB062
MELO3C011914Watermelon (Charleston Gray)mewcgB073
MELO3C011914Watermelon (97103) v1mewmB048
MELO3C011914Watermelon (97103) v1mewmB061
MELO3C011914Cucurbita pepo (Zucchini)cpemeB021
MELO3C011914Cucurbita pepo (Zucchini)cpemeB079
MELO3C011914Cucurbita pepo (Zucchini)cpemeB364
MELO3C011914Cucurbita pepo (Zucchini)cpemeB743