MELO3C010185 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ACTTAACACAATAATATATACTCTTTTGATTTCCTCATTCTCTTAGTTAAACCTCTTTGATTAATAACAATGGGTAGTTTGAAATCCTTGGTTCTTGCTGCTCTTCTTGTTTCCTCCTTCTTTGTTGTGTCCCAAAGCCGAGTGGCTAGGAAAGATTTGGGCCTTGACCTTGGTGGGGTGGGTATTGGGGTTGGAACTGGAATTGGCATTGGACTTGGTGGGAGTGGTTCAGGGTCCGGATCGGGCTCTGGCTCTGGCTCTGGATCGAGTTCGAGTTCCAGTTCTAGTTCTAGCTCTTCTTCTTCTGGATCAGGTTCTAATTCTGGATCTGAAGCAGGTTCATATGCAGGGTCTCGAGCGGGTTCTGGATCGAGTGGTCGTGGAGGTGAAGGTGGAGGGTCGGGTTATGGTGGAGGATATGGATCAGGTTATGGTGGGGGGCATGGAAAATGAGATGTTATTATCTTTTCAATTAACAAGTTG ACTTAACACAATAATATATACTCTTTTGATTTCCTCATTCTCTTAGTTAAACCTCTTTGATTAATAACAATGGGTAGTTTGAAATCCTTGGTTCTTGCTGCTCTTCTTGTTTCCTCCTTCTTTGTTGTGTCCCAAAGCCGAGTGGCTAGGAAAGATTTGGGCCTTGACCTTGGTGGGGTGGGTATTGGGGTTGGAACTGGAATTGGCATTGGACTTGGTGGGAGTGGTTCAGGGTCCGGATCGGGCTCTGGCTCTGGCTCTGGATCGAGTTCGAGTTCCAGTTCTAGTTCTAGCTCTTCTTCTTCTGGATCAGGTTCTAATTCTGGATCTGAAGCAGGTTCATATGCAGGGTCTCGAGCGGGTTCTGGATCGAGTGGTCGTGGAGGTGAAGGTGGAGGGTCGGGTTATGGTGGAGGATATGGATCAGGTTATGGTGGGGGGCATGGAAAATGAGATGTTATTATCTTTTCAATTAACAAGTTG ATGGGTAGTTTGAAATCCTTGGTTCTTGCTGCTCTTCTTGTTTCCTCCTTCTTTGTTGTGTCCCAAAGCCGAGTGGCTAGGAAAGATTTGGGCCTTGACCTTGGTGGGGTGGGTATTGGGGTTGGAACTGGAATTGGCATTGGACTTGGTGGGAGTGGTTCAGGGTCCGGATCGGGCTCTGGCTCTGGCTCTGGATCGAGTTCGAGTTCCAGTTCTAGTTCTAGCTCTTCTTCTTCTGGATCAGGTTCTAATTCTGGATCTGAAGCAGGTTCATATGCAGGGTCTCGAGCGGGTTCTGGATCGAGTGGTCGTGGAGGTGAAGGTGGAGGGTCGGGTTATGGTGGAGGATATGGATCAGGTTATGGTGGGGGGCATGGAAAATGA MGSLKSLVLAALLVSSFFVVSQSRVARKDLGLDLGGVGIGVGTGIGIGLGGSGSGSGSGSGSGSGSSSSSSSSSSSSSSGSGSNSGSEAGSYAGSRAGSGSSGRGGEGGGSGYGGGYGSGYGGGHGK*
BLAST of MELO3C010185 vs. Swiss-Prot
Match: FIBH_BOMMO (Fibroin heavy chain OS=Bombyx mori GN=FIBH PE=1 SV=4) HSP 1 Score: 99.4 bits (246), Expect = 3.1e-20 Identity = 50/97 (51.55%), Postives = 63/97 (64.95%), Query Frame = 1
HSP 2 Score: 97.8 bits (242), Expect = 9.0e-20 Identity = 48/93 (51.61%), Postives = 64/93 (68.82%), Query Frame = 1
HSP 3 Score: 97.8 bits (242), Expect = 9.0e-20 Identity = 49/97 (50.52%), Postives = 64/97 (65.98%), Query Frame = 1
HSP 4 Score: 97.8 bits (242), Expect = 9.0e-20 Identity = 49/97 (50.52%), Postives = 64/97 (65.98%), Query Frame = 1
HSP 5 Score: 97.4 bits (241), Expect = 1.2e-19 Identity = 46/93 (49.46%), Postives = 63/93 (67.74%), Query Frame = 1
HSP 6 Score: 97.1 bits (240), Expect = 1.5e-19 Identity = 47/93 (50.54%), Postives = 64/93 (68.82%), Query Frame = 1
HSP 7 Score: 97.1 bits (240), Expect = 1.5e-19 Identity = 47/95 (49.47%), Postives = 63/95 (66.32%), Query Frame = 1
HSP 8 Score: 97.1 bits (240), Expect = 1.5e-19 Identity = 47/95 (49.47%), Postives = 64/95 (67.37%), Query Frame = 1
HSP 9 Score: 95.9 bits (237), Expect = 3.4e-19 Identity = 47/95 (49.47%), Postives = 64/95 (67.37%), Query Frame = 1
HSP 10 Score: 95.9 bits (237), Expect = 3.4e-19 Identity = 47/93 (50.54%), Postives = 63/93 (67.74%), Query Frame = 1
HSP 11 Score: 95.5 bits (236), Expect = 4.5e-19 Identity = 46/92 (50.00%), Postives = 63/92 (68.48%), Query Frame = 1
HSP 12 Score: 95.5 bits (236), Expect = 4.5e-19 Identity = 46/95 (48.42%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 13 Score: 95.5 bits (236), Expect = 4.5e-19 Identity = 46/93 (49.46%), Postives = 63/93 (67.74%), Query Frame = 1
HSP 14 Score: 95.1 bits (235), Expect = 5.8e-19 Identity = 46/95 (48.42%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 15 Score: 95.1 bits (235), Expect = 5.8e-19 Identity = 45/92 (48.91%), Postives = 62/92 (67.39%), Query Frame = 1
HSP 16 Score: 95.1 bits (235), Expect = 5.8e-19 Identity = 46/95 (48.42%), Postives = 63/95 (66.32%), Query Frame = 1
HSP 17 Score: 94.7 bits (234), Expect = 7.6e-19 Identity = 44/93 (47.31%), Postives = 63/93 (67.74%), Query Frame = 1
HSP 18 Score: 94.4 bits (233), Expect = 9.9e-19 Identity = 45/92 (48.91%), Postives = 62/92 (67.39%), Query Frame = 1
HSP 19 Score: 94.4 bits (233), Expect = 9.9e-19 Identity = 45/92 (48.91%), Postives = 62/92 (67.39%), Query Frame = 1
HSP 20 Score: 94.4 bits (233), Expect = 9.9e-19 Identity = 46/93 (49.46%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 21 Score: 94.4 bits (233), Expect = 9.9e-19 Identity = 45/93 (48.39%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 22 Score: 94.0 bits (232), Expect = 1.3e-18 Identity = 45/93 (48.39%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 23 Score: 94.0 bits (232), Expect = 1.3e-18 Identity = 45/92 (48.91%), Postives = 63/92 (68.48%), Query Frame = 1
HSP 24 Score: 94.0 bits (232), Expect = 1.3e-18 Identity = 46/93 (49.46%), Postives = 63/93 (67.74%), Query Frame = 1
HSP 25 Score: 93.6 bits (231), Expect = 1.7e-18 Identity = 46/97 (47.42%), Postives = 64/97 (65.98%), Query Frame = 1
HSP 26 Score: 93.6 bits (231), Expect = 1.7e-18 Identity = 46/103 (44.66%), Postives = 64/103 (62.14%), Query Frame = 1
HSP 27 Score: 93.6 bits (231), Expect = 1.7e-18 Identity = 47/95 (49.47%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 28 Score: 93.6 bits (231), Expect = 1.7e-18 Identity = 47/93 (50.54%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 29 Score: 93.2 bits (230), Expect = 2.2e-18 Identity = 45/97 (46.39%), Postives = 63/97 (64.95%), Query Frame = 1
HSP 30 Score: 93.2 bits (230), Expect = 2.2e-18 Identity = 45/92 (48.91%), Postives = 62/92 (67.39%), Query Frame = 1
HSP 31 Score: 93.2 bits (230), Expect = 2.2e-18 Identity = 45/93 (48.39%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 32 Score: 92.8 bits (229), Expect = 2.9e-18 Identity = 47/92 (51.09%), Postives = 61/92 (66.30%), Query Frame = 1
HSP 33 Score: 92.8 bits (229), Expect = 2.9e-18 Identity = 47/95 (49.47%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 34 Score: 92.8 bits (229), Expect = 2.9e-18 Identity = 46/93 (49.46%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 35 Score: 92.8 bits (229), Expect = 2.9e-18 Identity = 46/97 (47.42%), Postives = 62/97 (63.92%), Query Frame = 1
HSP 36 Score: 92.4 bits (228), Expect = 3.8e-18 Identity = 46/97 (47.42%), Postives = 62/97 (63.92%), Query Frame = 1
HSP 37 Score: 92.4 bits (228), Expect = 3.8e-18 Identity = 47/93 (50.54%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 38 Score: 91.7 bits (226), Expect = 6.4e-18 Identity = 46/95 (48.42%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 39 Score: 91.7 bits (226), Expect = 6.4e-18 Identity = 46/93 (49.46%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 40 Score: 91.7 bits (226), Expect = 6.4e-18 Identity = 47/93 (50.54%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 41 Score: 91.7 bits (226), Expect = 6.4e-18 Identity = 47/93 (50.54%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 42 Score: 91.3 bits (225), Expect = 8.4e-18 Identity = 45/93 (48.39%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 43 Score: 90.9 bits (224), Expect = 1.1e-17 Identity = 47/95 (49.47%), Postives = 60/95 (63.16%), Query Frame = 1
HSP 44 Score: 90.9 bits (224), Expect = 1.1e-17 Identity = 44/93 (47.31%), Postives = 62/93 (66.67%), Query Frame = 1
HSP 45 Score: 90.9 bits (224), Expect = 1.1e-17 Identity = 44/95 (46.32%), Postives = 64/95 (67.37%), Query Frame = 1
HSP 46 Score: 90.9 bits (224), Expect = 1.1e-17 Identity = 46/93 (49.46%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 47 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/95 (48.42%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 48 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/92 (50.00%), Postives = 60/92 (65.22%), Query Frame = 1
HSP 49 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/92 (50.00%), Postives = 60/92 (65.22%), Query Frame = 1
HSP 50 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 45/101 (44.55%), Postives = 62/101 (61.39%), Query Frame = 1
HSP 51 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 45/105 (42.86%), Postives = 63/105 (60.00%), Query Frame = 1
HSP 52 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/92 (50.00%), Postives = 61/92 (66.30%), Query Frame = 1
HSP 53 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/95 (48.42%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 54 Score: 90.5 bits (223), Expect = 1.4e-17 Identity = 46/95 (48.42%), Postives = 60/95 (63.16%), Query Frame = 1
HSP 55 Score: 90.1 bits (222), Expect = 1.9e-17 Identity = 45/95 (47.37%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 56 Score: 89.7 bits (221), Expect = 2.4e-17 Identity = 45/93 (48.39%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 57 Score: 89.7 bits (221), Expect = 2.4e-17 Identity = 45/93 (48.39%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 58 Score: 89.7 bits (221), Expect = 2.4e-17 Identity = 46/95 (48.42%), Postives = 59/95 (62.11%), Query Frame = 1
HSP 59 Score: 89.7 bits (221), Expect = 2.4e-17 Identity = 45/93 (48.39%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 60 Score: 89.7 bits (221), Expect = 2.4e-17 Identity = 46/93 (49.46%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 61 Score: 89.4 bits (220), Expect = 3.2e-17 Identity = 44/95 (46.32%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 62 Score: 89.4 bits (220), Expect = 3.2e-17 Identity = 46/93 (49.46%), Postives = 61/93 (65.59%), Query Frame = 1
HSP 63 Score: 89.4 bits (220), Expect = 3.2e-17 Identity = 46/95 (48.42%), Postives = 60/95 (63.16%), Query Frame = 1
HSP 64 Score: 89.0 bits (219), Expect = 4.2e-17 Identity = 44/97 (45.36%), Postives = 62/97 (63.92%), Query Frame = 1
HSP 65 Score: 89.0 bits (219), Expect = 4.2e-17 Identity = 45/95 (47.37%), Postives = 60/95 (63.16%), Query Frame = 1
HSP 66 Score: 89.0 bits (219), Expect = 4.2e-17 Identity = 44/97 (45.36%), Postives = 62/97 (63.92%), Query Frame = 1
HSP 67 Score: 89.0 bits (219), Expect = 4.2e-17 Identity = 46/95 (48.42%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 68 Score: 89.0 bits (219), Expect = 4.2e-17 Identity = 45/93 (48.39%), Postives = 60/93 (64.52%), Query Frame = 1
HSP 69 Score: 88.6 bits (218), Expect = 5.4e-17 Identity = 45/92 (48.91%), Postives = 59/92 (64.13%), Query Frame = 1
HSP 70 Score: 88.6 bits (218), Expect = 5.4e-17 Identity = 45/93 (48.39%), Postives = 60/93 (64.52%), Query Frame = 1
HSP 71 Score: 88.6 bits (218), Expect = 5.4e-17 Identity = 46/101 (45.54%), Postives = 61/101 (60.40%), Query Frame = 1
HSP 72 Score: 88.6 bits (218), Expect = 5.4e-17 Identity = 51/106 (48.11%), Postives = 68/106 (64.15%), Query Frame = 1
HSP 73 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 45/93 (48.39%), Postives = 60/93 (64.52%), Query Frame = 1
HSP 74 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 48/105 (45.71%), Postives = 63/105 (60.00%), Query Frame = 1
HSP 75 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 45/92 (48.91%), Postives = 60/92 (65.22%), Query Frame = 1
HSP 76 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 45/93 (48.39%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 77 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 48/107 (44.86%), Postives = 62/107 (57.94%), Query Frame = 1
HSP 78 Score: 88.2 bits (217), Expect = 7.1e-17 Identity = 44/92 (47.83%), Postives = 61/92 (66.30%), Query Frame = 1
HSP 79 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 43/93 (46.24%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 80 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 47/100 (47.00%), Postives = 64/100 (64.00%), Query Frame = 1
HSP 81 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 46/95 (48.42%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 82 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 48/113 (42.48%), Postives = 64/113 (56.64%), Query Frame = 1
HSP 83 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 46/95 (48.42%), Postives = 61/95 (64.21%), Query Frame = 1
HSP 84 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 44/93 (47.31%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 85 Score: 87.8 bits (216), Expect = 9.3e-17 Identity = 46/97 (47.42%), Postives = 60/97 (61.86%), Query Frame = 1
HSP 86 Score: 87.4 bits (215), Expect = 1.2e-16 Identity = 44/92 (47.83%), Postives = 61/92 (66.30%), Query Frame = 1
HSP 87 Score: 87.4 bits (215), Expect = 1.2e-16 Identity = 44/90 (48.89%), Postives = 60/90 (66.67%), Query Frame = 1
HSP 88 Score: 87.4 bits (215), Expect = 1.2e-16 Identity = 45/97 (46.39%), Postives = 61/97 (62.89%), Query Frame = 1
HSP 89 Score: 87.4 bits (215), Expect = 1.2e-16 Identity = 44/97 (45.36%), Postives = 61/97 (62.89%), Query Frame = 1
HSP 90 Score: 86.7 bits (213), Expect = 2.1e-16 Identity = 43/92 (46.74%), Postives = 58/92 (63.04%), Query Frame = 1
HSP 91 Score: 86.7 bits (213), Expect = 2.1e-16 Identity = 44/93 (47.31%), Postives = 60/93 (64.52%), Query Frame = 1
HSP 92 Score: 86.7 bits (213), Expect = 2.1e-16 Identity = 43/93 (46.24%), Postives = 60/93 (64.52%), Query Frame = 1
HSP 93 Score: 86.7 bits (213), Expect = 2.1e-16 Identity = 42/92 (45.65%), Postives = 61/92 (66.30%), Query Frame = 1
HSP 94 Score: 86.7 bits (213), Expect = 2.1e-16 Identity = 48/101 (47.52%), Postives = 61/101 (60.40%), Query Frame = 1
HSP 95 Score: 86.3 bits (212), Expect = 2.7e-16 Identity = 44/95 (46.32%), Postives = 62/95 (65.26%), Query Frame = 1
HSP 96 Score: 86.3 bits (212), Expect = 2.7e-16 Identity = 44/93 (47.31%), Postives = 58/93 (62.37%), Query Frame = 1
HSP 97 Score: 86.3 bits (212), Expect = 2.7e-16 Identity = 43/97 (44.33%), Postives = 60/97 (61.86%), Query Frame = 1
HSP 98 Score: 86.3 bits (212), Expect = 2.7e-16 Identity = 43/90 (47.78%), Postives = 59/90 (65.56%), Query Frame = 1
HSP 99 Score: 86.3 bits (212), Expect = 2.7e-16 Identity = 44/93 (47.31%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 100 Score: 85.9 bits (211), Expect = 3.5e-16 Identity = 44/92 (47.83%), Postives = 59/92 (64.13%), Query Frame = 1
HSP 101 Score: 85.9 bits (211), Expect = 3.5e-16 Identity = 46/113 (40.71%), Postives = 61/113 (53.98%), Query Frame = 1
HSP 102 Score: 85.9 bits (211), Expect = 3.5e-16 Identity = 44/93 (47.31%), Postives = 59/93 (63.44%), Query Frame = 1
HSP 103 Score: 85.1 bits (209), Expect = 6.0e-16 Identity = 44/93 (47.31%), Postives = 57/93 (61.29%), Query Frame = 1
HSP 104 Score: 85.1 bits (209), Expect = 6.0e-16 Identity = 44/95 (46.32%), Postives = 60/95 (63.16%), Query Frame = 1
HSP 105 Score: 84.7 bits (208), Expect = 7.9e-16 Identity = 43/92 (46.74%), Postives = 57/92 (61.96%), Query Frame = 1
HSP 106 Score: 84.7 bits (208), Expect = 7.9e-16 Identity = 42/92 (45.65%), Postives = 59/92 (64.13%), Query Frame = 1
HSP 107 Score: 84.3 bits (207), Expect = 1.0e-15 Identity = 41/92 (44.57%), Postives = 56/92 (60.87%), Query Frame = 1
HSP 108 Score: 82.8 bits (203), Expect = 3.0e-15 Identity = 46/109 (42.20%), Postives = 61/109 (55.96%), Query Frame = 1
BLAST of MELO3C010185 vs. Swiss-Prot
Match: IFF6_CANAL (Cell wall protein IFF6 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) GN=IFF6 PE=1 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.9e-18 Identity = 57/103 (55.34%), Postives = 60/103 (58.25%), Query Frame = 1
HSP 2 Score: 92.4 bits (228), Expect = 3.8e-18 Identity = 53/97 (54.64%), Postives = 60/97 (61.86%), Query Frame = 1
HSP 3 Score: 85.9 bits (211), Expect = 3.5e-16 Identity = 51/101 (50.50%), Postives = 60/101 (59.41%), Query Frame = 1
HSP 4 Score: 84.3 bits (207), Expect = 1.0e-15 Identity = 49/97 (50.52%), Postives = 58/97 (59.79%), Query Frame = 1
HSP 5 Score: 81.6 bits (200), Expect = 6.7e-15 Identity = 47/98 (47.96%), Postives = 56/98 (57.14%), Query Frame = 1
HSP 6 Score: 60.8 bits (146), Expect = 1.2e-08 Identity = 37/79 (46.84%), Postives = 48/79 (60.76%), Query Frame = 1
HSP 7 Score: 60.1 bits (144), Expect = 2.1e-08 Identity = 39/83 (46.99%), Postives = 49/83 (59.04%), Query Frame = 1
HSP 8 Score: 53.1 bits (126), Expect = 2.5e-06 Identity = 28/84 (33.33%), Postives = 43/84 (51.19%), Query Frame = 1
HSP 9 Score: 45.4 bits (106), Expect = 5.3e-04 Identity = 32/73 (43.84%), Postives = 37/73 (50.68%), Query Frame = 1
HSP 10 Score: 32.3 bits (72), Expect = 4.6e+00 Identity = 20/55 (36.36%), Postives = 25/55 (45.45%), Query Frame = 1
HSP 11 Score: 29.3 bits (64), Expect = 3.9e+01 Identity = 17/52 (32.69%), Postives = 24/52 (46.15%), Query Frame = 1
HSP 12 Score: 28.9 bits (63), Expect = 5.1e+01 Identity = 17/46 (36.96%), Postives = 23/46 (50.00%), Query Frame = 1
BLAST of MELO3C010185 vs. Swiss-Prot
Match: PHXR5_MOUSE (Putative per-hexamer repeat protein 5 OS=Mus musculus GN=Phxr5 PE=5 SV=2) HSP 1 Score: 89.4 bits (220), Expect = 3.2e-17 Identity = 50/107 (46.73%), Postives = 60/107 (56.07%), Query Frame = 1
HSP 2 Score: 79.7 bits (195), Expect = 2.5e-14 Identity = 39/97 (40.21%), Postives = 59/97 (60.82%), Query Frame = 1
HSP 3 Score: 79.3 bits (194), Expect = 3.3e-14 Identity = 45/93 (48.39%), Postives = 56/93 (60.22%), Query Frame = 1
HSP 4 Score: 76.6 bits (187), Expect = 2.1e-13 Identity = 39/89 (43.82%), Postives = 54/89 (60.67%), Query Frame = 1
HSP 5 Score: 76.3 bits (186), Expect = 2.8e-13 Identity = 48/107 (44.86%), Postives = 60/107 (56.07%), Query Frame = 1
HSP 6 Score: 72.0 bits (175), Expect = 5.3e-12 Identity = 45/109 (41.28%), Postives = 57/109 (52.29%), Query Frame = 1
HSP 7 Score: 71.6 bits (174), Expect = 6.9e-12 Identity = 36/103 (34.95%), Postives = 59/103 (57.28%), Query Frame = 1
HSP 8 Score: 71.2 bits (173), Expect = 9.0e-12 Identity = 47/108 (43.52%), Postives = 55/108 (50.93%), Query Frame = 1
HSP 9 Score: 70.9 bits (172), Expect = 1.2e-11 Identity = 40/109 (36.70%), Postives = 62/109 (56.88%), Query Frame = 1
HSP 10 Score: 70.1 bits (170), Expect = 2.0e-11 Identity = 48/127 (37.80%), Postives = 60/127 (47.24%), Query Frame = 1
HSP 11 Score: 67.8 bits (164), Expect = 1.0e-10 Identity = 46/123 (37.40%), Postives = 62/123 (50.41%), Query Frame = 1
HSP 12 Score: 67.0 bits (162), Expect = 1.7e-10 Identity = 35/107 (32.71%), Postives = 59/107 (55.14%), Query Frame = 1
HSP 13 Score: 63.9 bits (154), Expect = 1.4e-09 Identity = 35/115 (30.43%), Postives = 60/115 (52.17%), Query Frame = 1
HSP 14 Score: 62.4 bits (150), Expect = 4.2e-09 Identity = 37/121 (30.58%), Postives = 61/121 (50.41%), Query Frame = 1
HSP 15 Score: 62.0 bits (149), Expect = 5.5e-09 Identity = 34/108 (31.48%), Postives = 58/108 (53.70%), Query Frame = 1
HSP 16 Score: 60.8 bits (146), Expect = 1.2e-08 Identity = 33/93 (35.48%), Postives = 53/93 (56.99%), Query Frame = 1
HSP 17 Score: 58.2 bits (139), Expect = 7.9e-08 Identity = 36/129 (27.91%), Postives = 57/129 (44.19%), Query Frame = 1
HSP 18 Score: 44.7 bits (104), Expect = 9.0e-04 Identity = 25/87 (28.74%), Postives = 48/87 (55.17%), Query Frame = 1
HSP 19 Score: 39.7 bits (91), Expect = 2.9e-02 Identity = 26/92 (28.26%), Postives = 44/92 (47.83%), Query Frame = 1
BLAST of MELO3C010185 vs. Swiss-Prot
Match: EBNA1_EBVA8 (Epstein-Barr nuclear antigen 1 OS=Epstein-Barr virus (strain AG876) GN=EBNA1 PE=1 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.3e-15 Identity = 40/94 (42.55%), Postives = 56/94 (59.57%), Query Frame = 1
HSP 2 Score: 82.4 bits (202), Expect = 3.9e-15 Identity = 41/100 (41.00%), Postives = 57/100 (57.00%), Query Frame = 1
HSP 3 Score: 82.4 bits (202), Expect = 3.9e-15 Identity = 39/96 (40.62%), Postives = 55/96 (57.29%), Query Frame = 1
HSP 4 Score: 82.0 bits (201), Expect = 5.1e-15 Identity = 40/94 (42.55%), Postives = 56/94 (59.57%), Query Frame = 1
HSP 5 Score: 82.0 bits (201), Expect = 5.1e-15 Identity = 40/94 (42.55%), Postives = 56/94 (59.57%), Query Frame = 1
HSP 6 Score: 81.6 bits (200), Expect = 6.7e-15 Identity = 41/97 (42.27%), Postives = 58/97 (59.79%), Query Frame = 1
HSP 7 Score: 81.6 bits (200), Expect = 6.7e-15 Identity = 41/106 (38.68%), Postives = 57/106 (53.77%), Query Frame = 1
HSP 8 Score: 78.6 bits (192), Expect = 5.6e-14 Identity = 35/96 (36.46%), Postives = 50/96 (52.08%), Query Frame = 1
HSP 9 Score: 77.4 bits (189), Expect = 1.3e-13 Identity = 37/98 (37.76%), Postives = 53/98 (54.08%), Query Frame = 1
HSP 10 Score: 76.3 bits (186), Expect = 2.8e-13 Identity = 40/95 (42.11%), Postives = 53/95 (55.79%), Query Frame = 1
HSP 11 Score: 73.9 bits (180), Expect = 1.4e-12 Identity = 39/98 (39.80%), Postives = 54/98 (55.10%), Query Frame = 1
HSP 12 Score: 71.6 bits (174), Expect = 6.9e-12 Identity = 35/96 (36.46%), Postives = 49/96 (51.04%), Query Frame = 1
HSP 13 Score: 55.8 bits (133), Expect = 3.9e-07 Identity = 33/96 (34.38%), Postives = 39/96 (40.62%), Query Frame = 1
BLAST of MELO3C010185 vs. Swiss-Prot
Match: HYR1_CANAX (Hyphally-regulated protein OS=Candida albicans GN=HYR1 PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.0e-15 Identity = 49/95 (51.58%), Postives = 51/95 (53.68%), Query Frame = 1
HSP 2 Score: 79.3 bits (194), Expect = 3.3e-14 Identity = 52/108 (48.15%), Postives = 55/108 (50.93%), Query Frame = 1
HSP 3 Score: 79.0 bits (193), Expect = 4.3e-14 Identity = 48/92 (52.17%), Postives = 52/92 (56.52%), Query Frame = 1
HSP 4 Score: 74.7 bits (182), Expect = 8.1e-13 Identity = 52/107 (48.60%), Postives = 58/107 (54.21%), Query Frame = 1
HSP 5 Score: 74.3 bits (181), Expect = 1.1e-12 Identity = 48/101 (47.52%), Postives = 49/101 (48.51%), Query Frame = 1
HSP 6 Score: 70.5 bits (171), Expect = 1.5e-11 Identity = 44/91 (48.35%), Postives = 50/91 (54.95%), Query Frame = 1
HSP 7 Score: 69.3 bits (168), Expect = 3.4e-11 Identity = 47/111 (42.34%), Postives = 52/111 (46.85%), Query Frame = 1
HSP 8 Score: 64.7 bits (156), Expect = 8.4e-10 Identity = 45/109 (41.28%), Postives = 49/109 (44.95%), Query Frame = 1
HSP 9 Score: 62.4 bits (150), Expect = 4.2e-09 Identity = 36/73 (49.32%), Postives = 43/73 (58.90%), Query Frame = 1
HSP 10 Score: 60.1 bits (144), Expect = 2.1e-08 Identity = 38/80 (47.50%), Postives = 43/80 (53.75%), Query Frame = 1
HSP 11 Score: 59.3 bits (142), Expect = 3.5e-08 Identity = 34/77 (44.16%), Postives = 40/77 (51.95%), Query Frame = 1
HSP 12 Score: 57.4 bits (137), Expect = 1.3e-07 Identity = 36/86 (41.86%), Postives = 40/86 (46.51%), Query Frame = 1
HSP 13 Score: 40.8 bits (94), Expect = 1.3e-02 Identity = 25/61 (40.98%), Postives = 35/61 (57.38%), Query Frame = 1
HSP 14 Score: 30.0 bits (66), Expect = 2.3e+01 Identity = 18/49 (36.73%), Postives = 24/49 (48.98%), Query Frame = 1
HSP 15 Score: 28.1 bits (61), Expect = 8.7e+01 Identity = 16/50 (32.00%), Postives = 28/50 (56.00%), Query Frame = 1
HSP 16 Score: 27.7 bits (60), Expect = 1.1e+02 Identity = 23/61 (37.70%), Postives = 29/61 (47.54%), Query Frame = 1
BLAST of MELO3C010185 vs. TrEMBL
Match: F6HS59_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0051g00680 PE=4 SV=1) HSP 1 Score: 179.1 bits (453), Expect = 3.4e-42 Identity = 94/129 (72.87%), Postives = 103/129 (79.84%), Query Frame = 1
BLAST of MELO3C010185 vs. TrEMBL
Match: F6HS59_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_05s0051g00680 PE=4 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 1.3e-33 Identity = 88/161 (54.66%), Postives = 101/161 (62.73%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 1.8e-06 Identity = 42/90 (46.67%), Postives = 44/90 (48.89%), Query Frame = 1
HSP 3 Score: 177.6 bits (449), Expect = 9.9e-42 Identity = 94/131 (71.76%), Postives = 102/131 (77.86%), Query Frame = 1
BLAST of MELO3C010185 vs. TrEMBL
Match: A5AIY9_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_013093 PE=4 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 3.2e-32 Identity = 89/163 (54.60%), Postives = 100/163 (61.35%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 1.8e-06 Identity = 42/90 (46.67%), Postives = 44/90 (48.89%), Query Frame = 1
HSP 3 Score: 167.5 bits (423), Expect = 1.0e-38 Identity = 92/127 (72.44%), Postives = 104/127 (81.89%), Query Frame = 1
BLAST of MELO3C010185 vs. TrEMBL
Match: A0A072V362_MEDTR (Uncharacterized protein OS=Medicago truncatula GN=MTR_4g129760 PE=4 SV=1) HSP 1 Score: 35.8 bits (81), Expect = 4.7e+01 Identity = 19/31 (61.29%), Postives = 19/31 (61.29%), Query Frame = 1
HSP 2 Score: 165.2 bits (417), Expect = 5.1e-38 Identity = 90/130 (69.23%), Postives = 103/130 (79.23%), Query Frame = 1
BLAST of MELO3C010185 vs. TrEMBL
Match: V7CBV4_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_003G152100g PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.7e-17 Identity = 60/159 (37.74%), Postives = 74/159 (46.54%), Query Frame = 1
HSP 2 Score: 163.3 bits (412), Expect = 1.9e-37 Identity = 92/134 (68.66%), Postives = 104/134 (77.61%), Query Frame = 1
BLAST of MELO3C010185 vs. TAIR10
Match: AT4G30460.1 (AT4G30460.1 glycine-rich protein) HSP 1 Score: 165.6 bits (418), Expect = 2.0e-41 Identity = 86/129 (66.67%), Postives = 99/129 (76.74%), Query Frame = 1
HSP 2 Score: 161.4 bits (407), Expect = 3.7e-40 Identity = 88/146 (60.27%), Postives = 103/146 (70.55%), Query Frame = 1
BLAST of MELO3C010185 vs. TAIR10
Match: AT4G30450.1 (AT4G30450.1 glycine-rich protein) HSP 1 Score: 134.4 bits (337), Expect = 4.9e-32 Identity = 68/97 (70.10%), Postives = 84/97 (86.60%), Query Frame = 1
HSP 2 Score: 93.6 bits (231), Expect = 9.5e-20 Identity = 54/116 (46.55%), Postives = 70/116 (60.34%), Query Frame = 1
BLAST of MELO3C010185 vs. TAIR10
Match: AT5G46730.1 (AT5G46730.1 glycine-rich protein) HSP 1 Score: 86.3 bits (212), Expect = 1.5e-17 Identity = 45/94 (47.87%), Postives = 47/94 (50.00%), Query Frame = 1
HSP 2 Score: 75.9 bits (185), Expect = 2.1e-14 Identity = 42/97 (43.30%), Postives = 45/97 (46.39%), Query Frame = 1
HSP 3 Score: 73.2 bits (178), Expect = 1.3e-13 Identity = 42/93 (45.16%), Postives = 44/93 (47.31%), Query Frame = 1
HSP 4 Score: 70.9 bits (172), Expect = 6.6e-13 Identity = 40/92 (43.48%), Postives = 45/92 (48.91%), Query Frame = 1
HSP 5 Score: 70.1 bits (170), Expect = 1.1e-12 Identity = 43/104 (41.35%), Postives = 48/104 (46.15%), Query Frame = 1
HSP 6 Score: 62.8 bits (151), Expect = 1.8e-10 Identity = 40/96 (41.67%), Postives = 42/96 (43.75%), Query Frame = 1
HSP 7 Score: 27.3 bits (59), Expect = 8.4e+00 Identity = 17/32 (53.12%), Postives = 15/32 (46.88%), Query Frame = 1
BLAST of MELO3C010185 vs. TAIR10
Match: AT3G20470.1 (AT3G20470.1 glycine-rich protein 5) HSP 1 Score: 84.3 bits (207), Expect = 5.8e-17 Identity = 59/157 (37.58%), Postives = 69/157 (43.95%), Query Frame = 1
HSP 2 Score: 66.6 bits (161), Expect = 1.2e-11 Identity = 38/87 (43.68%), Postives = 43/87 (49.43%), Query Frame = 1
HSP 3 Score: 65.9 bits (159), Expect = 2.1e-11 Identity = 39/98 (39.80%), Postives = 43/98 (43.88%), Query Frame = 1
BLAST of MELO3C010185 vs. TAIR10
Match: AT2G36120.1 (AT2G36120.1 Glycine-rich protein family) HSP 1 Score: 83.6 bits (205), Expect = 9.9e-17 Identity = 41/92 (44.57%), Postives = 47/92 (51.09%), Query Frame = 1
HSP 2 Score: 75.5 bits (184), Expect = 2.7e-14 Identity = 53/120 (44.17%), Postives = 58/120 (48.33%), Query Frame = 1
HSP 3 Score: 74.7 bits (182), Expect = 4.6e-14 Identity = 39/92 (42.39%), Postives = 43/92 (46.74%), Query Frame = 1
HSP 4 Score: 70.5 bits (171), Expect = 8.6e-13 Identity = 40/106 (37.74%), Postives = 44/106 (41.51%), Query Frame = 1
HSP 5 Score: 69.7 bits (169), Expect = 1.5e-12 Identity = 39/99 (39.39%), Postives = 41/99 (41.41%), Query Frame = 1
BLAST of MELO3C010185 vs. NCBI nr
Match: gi|147775987|emb|CAN75720.1| (hypothetical protein VITISV_013093 [Vitis vinifera]) HSP 1 Score: 177.6 bits (449), Expect = 1.4e-41 Identity = 94/131 (71.76%), Postives = 102/131 (77.86%), Query Frame = 1
BLAST of MELO3C010185 vs. NCBI nr
Match: gi|147775987|emb|CAN75720.1| (hypothetical protein VITISV_013093 [Vitis vinifera]) HSP 1 Score: 146.0 bits (367), Expect = 4.6e-32 Identity = 89/163 (54.60%), Postives = 100/163 (61.35%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 2.5e-06 Identity = 42/90 (46.67%), Postives = 44/90 (48.89%), Query Frame = 1
HSP 3 Score: 172.6 bits (436), Expect = 4.6e-40 Identity = 93/133 (69.92%), Postives = 106/133 (79.70%), Query Frame = 1
BLAST of MELO3C010185 vs. NCBI nr
Match: gi|566215231|ref|XP_006372107.1| (hypothetical protein POPTR_0018s10920g [Populus trichocarpa]) HSP 1 Score: 172.2 bits (435), Expect = 6.0e-40 Identity = 91/134 (67.91%), Postives = 104/134 (77.61%), Query Frame = 1
BLAST of MELO3C010185 vs. NCBI nr
Match: gi|566215231|ref|XP_006372107.1| (hypothetical protein POPTR_0018s10920g [Populus trichocarpa]) HSP 1 Score: 140.2 bits (352), Expect = 2.5e-30 Identity = 82/150 (54.67%), Postives = 95/150 (63.33%), Query Frame = 1
HSP 2 Score: 167.5 bits (423), Expect = 1.5e-38 Identity = 92/127 (72.44%), Postives = 104/127 (81.89%), Query Frame = 1
BLAST of MELO3C010185 vs. NCBI nr
Match: gi|922372805|ref|XP_013458559.1| (hypothetical protein MTR_4g129760 [Medicago truncatula]) HSP 1 Score: 35.8 bits (81), Expect = 6.7e+01 Identity = 19/31 (61.29%), Postives = 19/31 (61.29%), Query Frame = 1
HSP 2 Score: 167.2 bits (422), Expect = 1.9e-38 Identity = 87/129 (67.44%), Postives = 102/129 (79.07%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |