MELO3C005453 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: polypeptideCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACAAGACCTAACATACTTGGAATCATAGTTCCTATCGGAACGGGAGAAATTGAGTCATTAGAATCGTCTGACCTATCTTTCAATAATTTTTCAGGCAACATTCCTCGAGAGGGTCATCTTTCCACATTCAACGAGGCTTCAAGTTTTGATAATAATCCATATCTTTGCAGAGAACCACTCCCAATAAAATGTGTGACTGAGAATCCATGGAAACGACATTGA ATGACAAGACCTAACATACTTGGAATCATAGTTCCTATCGGAACGGGAGAAATTGAGTCATTAGAATCGTCTGACCTATCTTTCAATAATTTTTCAGGCAACATTCCTCGAGAGGGTCATCTTTCCACATTCAACGAGGCTTCAAGTTTTGATAATAATCCATATCTTTGCAGAGAACCACTCCCAATAAAATGTGTGACTGAGAATCCATGGAAACGACATTGA ATGACAAGACCTAACATACTTGGAATCATAGTTCCTATCGGAACGGGAGAAATTGAGTCATTAGAATCGTCTGACCTATCTTTCAATAATTTTTCAGGCAACATTCCTCGAGAGGGTCATCTTTCCACATTCAACGAGGCTTCAAGTTTTGATAATAATCCATATCTTTGCAGAGAACCACTCCCAATAAAATGTGTGACTGAGAATCCATGGAAACGACATTGA MTRPNILGIIVPIGTGEIESLESSDLSFNNFSGNIPREGHLSTFNEASSFDNNPYLCREPLPIKCVTENPWKRH*
BLAST of MELO3C005453 vs. TrEMBL
Match: A0A0K9QYH1_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_133890 PE=4 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.4e-08 Identity = 31/59 (52.54%), Postives = 38/59 (64.41%), Query Frame = 1
BLAST of MELO3C005453 vs. TrEMBL
Match: A0A0K9QYH1_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_133890 PE=4 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 4.8e-04 Identity = 29/83 (34.94%), Postives = 39/83 (46.99%), Query Frame = 1
HSP 2 Score: 29.3 bits (64), Expect = 2.6e+03 Identity = 17/45 (37.78%), Postives = 23/45 (51.11%), Query Frame = 1
HSP 3 Score: 64.7 bits (156), Expect = 5.5e-08 Identity = 30/65 (46.15%), Postives = 40/65 (61.54%), Query Frame = 1
BLAST of MELO3C005453 vs. TrEMBL
Match: A0A0J8CWA4_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_3g055140 PE=4 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 1.0e+02 Identity = 16/40 (40.00%), Postives = 26/40 (65.00%), Query Frame = 1
HSP 2 Score: 59.7 bits (143), Expect = 1.8e-06 Identity = 27/61 (44.26%), Postives = 39/61 (63.93%), Query Frame = 1
BLAST of MELO3C005453 vs. TrEMBL
Match: W1P2J1_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s01798p00005570 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 5.1e-06 Identity = 25/55 (45.45%), Postives = 37/55 (67.27%), Query Frame = 1
BLAST of MELO3C005453 vs. TrEMBL
Match: W1NIJ5_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00009p00246120 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.7e-06 Identity = 25/55 (45.45%), Postives = 36/55 (65.45%), Query Frame = 1
BLAST of MELO3C005453 vs. TAIR10
Match: AT1G75820.1 (AT1G75820.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 48.9 bits (115), Expect = 1.6e-06 Identity = 26/57 (45.61%), Postives = 31/57 (54.39%), Query Frame = 1
BLAST of MELO3C005453 vs. TAIR10
Match: AT4G20270.1 (AT4G20270.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 47.4 bits (111), Expect = 4.6e-06 Identity = 23/47 (48.94%), Postives = 29/47 (61.70%), Query Frame = 1
BLAST of MELO3C005453 vs. NCBI nr
Match: gi|659073238|ref|XP_008467326.1| (PREDICTED: probable leucine-rich repeat receptor-like protein kinase At1g35710 isoform X1 [Cucumis melo]) HSP 1 Score: 110.2 bits (274), Expect = 1.6e-21 Identity = 54/69 (78.26%), Postives = 59/69 (85.51%), Query Frame = 1
BLAST of MELO3C005453 vs. NCBI nr
Match: gi|659073240|ref|XP_008467327.1| (PREDICTED: probable leucine-rich repeat receptor-like protein kinase At1g35710 isoform X2 [Cucumis melo]) HSP 1 Score: 109.0 bits (271), Expect = 3.6e-21 Identity = 53/69 (76.81%), Postives = 59/69 (85.51%), Query Frame = 1
BLAST of MELO3C005453 vs. NCBI nr
Match: gi|659074635|ref|XP_008437710.1| (PREDICTED: receptor-like protein 12 [Cucumis melo]) HSP 1 Score: 93.2 bits (230), Expect = 2.1e-16 Identity = 51/92 (55.43%), Postives = 58/92 (63.04%), Query Frame = 1
BLAST of MELO3C005453 vs. NCBI nr
Match: gi|659074631|ref|XP_008437708.1| (PREDICTED: LRR receptor-like serine/threonine-protein kinase FLS2 [Cucumis melo]) HSP 1 Score: 90.9 bits (224), Expect = 1.0e-15 Identity = 51/93 (54.84%), Postives = 57/93 (61.29%), Query Frame = 1
BLAST of MELO3C005453 vs. NCBI nr
Match: gi|778700366|ref|XP_004143731.2| (PREDICTED: receptor-like protein 12 [Cucumis sativus]) HSP 1 Score: 90.5 bits (223), Expect = 1.3e-15 Identity = 50/96 (52.08%), Postives = 60/96 (62.50%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|