MELO3C005021.2 (gene) Melon (DHL92) v3.6.1
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ACAAGGGGTTCGATAGGAAAGTCCTTTCGATCCAATCAATTTTTTGAGTCAAATAAAGATAAAGGATATGTTAGTGATGTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAGTCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGACCGAAATACAAGAAAACTCCATTCAATTCTCGATGGAATCGGAGTTTTTCAAATTTTTCCTAGAACTGACAGATCATTTGGAGATCTTCTCTAAGACTCTAAGGTTCAATGTGACTATTGTCAATTTTGCCAAGACAAAAGATGAGACTTTACCATTGTAA ACAAGGGGTTCGATAGGAAAGTCCTTTCGATCCAATCAATTTTTTGAGTCAAATAAAGATAAAGGATATGTTAGTGATGTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAGTCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGACCGAAATACAAGAAAACTCCATTCAATTCTCGATGGAATCGGAGTTTTTCAAATTTTTCCTAGAACTGACAGATCATTTGGAGATCTTCTCTAAGACTCTAAGGTTCAATGTGACTATTGTCAATTTTGCCAAGACAAAAGATGAGACTTTACCATTGTAA ACAAGGGGTTCGATAGGAAAGTCCTTTCGATCCAATCAATTTTTTGAGTCAAATAAAGATAAAGGATATGTTAGTGATGTAGCACGAGAAAGCACTCTCCGAGGGCATGAAATGTCTAATTTTTCTTTCAAAGTCATTATAGGAATAGTAATGTCTTTCTTAAATTCTCCGACCGAAATACAAGAAAACTCCATTCAATTCTCGATGGAATCGGAGTTTTTCAAATTTTTCCTAGAACTGACAGATCATTTGGAGATCTTCTCTAAGACTCTAAGGTTCAATGTGACTATTGTCAATTTTGCCAAGACAAAAGATGAGACTTTACCATTGTAA TRGSIGKSFRSNQFFESNKDKGYVSDVARESTLRGHEMSNFSFKVIIGIVMSFLNSPTEIQENSIQFSMESEFFKFFLELTDHLEIFSKTLRFNVTIVNFAKTKDETLPL
BLAST of MELO3C005021.2 vs. NCBI nr
Match: AEN56134.1 (ribosomal protein L5 (mitochondrion) [Cucumis melo subsp. melo]) HSP 1 Score: 179.5 bits (454), Expect = 6.3e-42 Identity = 91/109 (83.49%), Postives = 99/109 (90.83%), Query Frame = 0
BLAST of MELO3C005021.2 vs. NCBI nr
Match: YP_004849341.1 (ribosomal protein L5 (mitochondrion) [Cucumis sativus] >ADZ10768.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus]) HSP 1 Score: 164.5 bits (415), Expect = 2.1e-37 Identity = 84/109 (77.06%), Postives = 94/109 (86.24%), Query Frame = 0
BLAST of MELO3C005021.2 vs. NCBI nr
Match: AAP33159.1 (ribosomal protein L5 (mitochondrion) [Cucumis sativus] >AAP33161.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus] >AAP33162.1 ribosomal protein L5 (mitochondrion) [Cucumis sativus]) HSP 1 Score: 162.2 bits (409), Expect = 1.0e-36 Identity = 84/110 (76.36%), Postives = 94/110 (85.45%), Query Frame = 0
BLAST of MELO3C005021.2 vs. NCBI nr
Match: AFY03535.1 (ribosomal protein L5, partial (mitochondrion) [Lagenaria siceraria]) HSP 1 Score: 141.7 bits (356), Expect = 1.4e-30 Identity = 78/108 (72.22%), Postives = 85/108 (78.70%), Query Frame = 0
BLAST of MELO3C005021.2 vs. NCBI nr
Match: YP_002608355.1 (ribosomal protein L5 [Vitis vinifera] >CAQ77587.1 ribosomal protein L5 (mitochondrion) [Vitis vinifera] >ACS15246.1 ribosomal protein L5 (mitochondrion) [Vitis vinifera]) HSP 1 Score: 141.0 bits (354), Expect = 2.5e-30 Identity = 78/108 (72.22%), Postives = 85/108 (78.70%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TAIR10
Match: AT2G07725.1 (Ribosomal L5P family protein) HSP 1 Score: 134.0 bits (336), Expect = 5.5e-32 Identity = 74/109 (67.89%), Postives = 83/109 (76.15%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TAIR10
Match: ATMG00210.1 (ribosomal protein L5) HSP 1 Score: 134.0 bits (336), Expect = 5.5e-32 Identity = 74/109 (67.89%), Postives = 83/109 (76.15%), Query Frame = 0
BLAST of MELO3C005021.2 vs. Swiss-Prot
Match: sp|P49388|RM05_BRANA (60S ribosomal protein L5, mitochondrial OS=Brassica napus OX=3708 GN=RPL5 PE=3 SV=2) HSP 1 Score: 133.3 bits (334), Expect = 1.7e-30 Identity = 74/109 (67.89%), Postives = 83/109 (76.15%), Query Frame = 0
BLAST of MELO3C005021.2 vs. Swiss-Prot
Match: sp|Q05492|RM05_OENBE (60S ribosomal protein L5, mitochondrial OS=Oenothera berteroana OX=3950 GN=RPL5 PE=2 SV=2) HSP 1 Score: 132.1 bits (331), Expect = 3.8e-30 Identity = 73/109 (66.97%), Postives = 83/109 (76.15%), Query Frame = 0
BLAST of MELO3C005021.2 vs. Swiss-Prot
Match: sp|P42793|RM05_ARATH (60S ribosomal protein L5, mitochondrial OS=Arabidopsis thaliana OX=3702 GN=RPL5 PE=2 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 5.4e-29 Identity = 70/109 (64.22%), Postives = 82/109 (75.23%), Query Frame = 0
BLAST of MELO3C005021.2 vs. Swiss-Prot
Match: sp|P51409|RM05_SOLTU (60S ribosomal protein L5, mitochondrial OS=Solanum tuberosum OX=4113 GN=RPL5 PE=2 SV=2) HSP 1 Score: 120.6 bits (301), Expect = 1.1e-26 Identity = 72/110 (65.45%), Postives = 80/110 (72.73%), Query Frame = 0
BLAST of MELO3C005021.2 vs. Swiss-Prot
Match: sp|P26860|RM05_MARPO (60S ribosomal protein L5, mitochondrial OS=Marchantia polymorpha OX=3197 GN=RPL5 PE=3 SV=2) HSP 1 Score: 93.6 bits (231), Expect = 1.5e-18 Identity = 57/113 (50.44%), Postives = 75/113 (66.37%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TrEMBL
Match: tr|G3EU44|G3EU44_CUCME (Ribosomal protein L5 OS=Cucumis melo subsp. melo OX=412675 GN=rpl5 PE=4 SV=1) HSP 1 Score: 179.5 bits (454), Expect = 4.1e-42 Identity = 91/109 (83.49%), Postives = 99/109 (90.83%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TrEMBL
Match: tr|G3EIZ3|G3EIZ3_CUCSA (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=4 SV=1) HSP 1 Score: 164.5 bits (415), Expect = 1.4e-37 Identity = 84/109 (77.06%), Postives = 94/109 (86.24%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TrEMBL
Match: tr|Q7Y6H0|Q7Y6H0_CUCSA (Ribosomal protein L5 OS=Cucumis sativus OX=3659 GN=rpl5 PE=4 SV=1) HSP 1 Score: 162.2 bits (409), Expect = 6.8e-37 Identity = 84/110 (76.36%), Postives = 94/110 (85.45%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TrEMBL
Match: tr|K7Z325|K7Z325_LAGSI (Ribosomal protein L5 (Fragment) OS=Lagenaria siceraria OX=3668 PE=4 SV=1) HSP 1 Score: 141.7 bits (356), Expect = 9.6e-31 Identity = 78/108 (72.22%), Postives = 85/108 (78.70%), Query Frame = 0
BLAST of MELO3C005021.2 vs. TrEMBL
Match: tr|B6VJT5|B6VJT5_VITVI (Ribosomal protein L5 OS=Vitis vinifera OX=29760 GN=rpl5 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 1.6e-30 Identity = 78/108 (72.22%), Postives = 85/108 (78.70%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon v3.6.1
Date Performed: 2018-09-25
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |