MELO3C003985 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCACGTCGAGGTACTGCAGAAGAAACAATTGCAAAATTCGATCCAATTTATTATAATCGATCAGTTAACATGTTGGTTAACCGTATTTTAAAACATGGAAAGAAATCATTGGCTTATCAAATTATCTATCGAGCCATGAAAAGATTCAACAAAAGACATAAACAAATCCACTATCTATTTTATGTCAAACAATACGTGGAGTAACTCCCGATATAGTAGTAAAGGCAAGATGTGTAGGCGGATCAACTCATCAAGTTCCCATTGAAATAGGATCCACACAAAGAAAAGCACTTGCCATTCGTTGGTTATTAGGAGCATCCCGAAAACGTCGGGGTCGAAATATCGCTTTCAAATTAAGTTCTGAATTAGTGGATGCTGCCAAAGGGAGTGGCGATGCCATACGTAAAAAGGAAGAGACTCATAGAATGGCAAAGGCAAATAGAGATTTTGCACATTTTCGTTAA ATGTCACGTCGAGGAGCATCCCGAAAACGTCGGGGTCGAAATATCGCTTTCAAATTAAGTTCTGAATTAGTGGATGCTGCCAAAGGGAGTGGCGATGCCATACGTAAAAAGGAAGAGACTCATAGAATGGCAAAGGCAAATAGAGATTTTGCACATTTTCGTTAA ATGTCACGTCGAGGAGCATCCCGAAAACGTCGGGGTCGAAATATCGCTTTCAAATTAAGTTCTGAATTAGTGGATGCTGCCAAAGGGAGTGGCGATGCCATACGTAAAAAGGAAGAGACTCATAGAATGGCAAAGGCAAATAGAGATTTTGCACATTTTCGTTAA MSRRGASRKRRGRNIAFKLSSELVDAAKGSGDAIRKKEETHRMAKANRDFAHFR*
BLAST of MELO3C003985 vs. Swiss-Prot
Match: RR7_BRANA (30S ribosomal protein S7, chloroplastic OS=Brassica napus GN=rps7 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.2e-18 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. Swiss-Prot
Match: RR7_MANES (30S ribosomal protein S7, chloroplastic OS=Manihot esculenta GN=rps7-A PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.2e-18 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. Swiss-Prot
Match: RR7_NANDO (30S ribosomal protein S7, chloroplastic OS=Nandina domestica GN=rps7-A PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.2e-18 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. Swiss-Prot
Match: RR7_NASOF (30S ribosomal protein S7, chloroplastic OS=Nasturtium officinale GN=rps7-A PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.2e-18 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. Swiss-Prot
Match: RR7_GOSHI (30S ribosomal protein S7, chloroplastic OS=Gossypium hirsutum GN=rps7-A PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.2e-18 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TrEMBL
Match: Q67IN3_9LILI (30S ribosomal protein S7, chloroplastic OS=Burmannia capitata GN=rps7 PE=3 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.1e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TrEMBL
Match: A0ARS4_9POAL (Ribosomal protein S7 OS=Flagellaria indica GN=rps7 PE=3 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.1e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TrEMBL
Match: A0A158USQ6_9FABA (Ribosomal protein S7 OS=Indigofera tinctoria GN=rps7 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.1e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TrEMBL
Match: A0A0K0VIS9_9LILI (Ribosomal protein S7 OS=Xerophyta retinervis GN=rps7 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.4e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TrEMBL
Match: H9TUI6_9ASPA (Ribosomal protein S7 (Fragment) OS=Neoastelia spectabilis GN=rps7 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.4e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TAIR10
Match: ATCG01240.1 (ATCG01240.1 ribosomal protein S7) HSP 1 Score: 92.8 bits (229), Expect = 7.0e-20 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. TAIR10
Match: ATCG00900.1 (ATCG00900.1 Ribosomal protein S7p/S5e family protein) HSP 1 Score: 92.8 bits (229), Expect = 7.0e-20 Identity = 46/50 (92.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of MELO3C003985 vs. NCBI nr
Match: gi|37721183|gb|AAN31970.1| (ribosomal protein S7 (chloroplast) [Burmannia capitata]) HSP 1 Score: 93.2 bits (230), Expect = 1.5e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. NCBI nr
Match: gi|45454104|gb|AAS65718.1| (ribosomal protein S7 (chloroplast) [Flagellaria indica]) HSP 1 Score: 93.2 bits (230), Expect = 1.5e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. NCBI nr
Match: gi|948299653|ref|YP_009179115.1| (ribosomal protein S7 (chloroplast) [Ostrya rehderiana]) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. NCBI nr
Match: gi|757609152|ref|WP_042854974.1| (30S ribosomal protein S7 [Staphylococcus aureus]) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
BLAST of MELO3C003985 vs. NCBI nr
Match: gi|669100496|ref|YP_009048620.1| (30S ribosomal protein S7 [Paris verticillata]) HSP 1 Score: 92.8 bits (229), Expect = 2.0e-16 Identity = 46/50 (92.00%), Postives = 48/50 (96.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |