Lsi06G001250 (gene) Bottle gourd (USVL1VR-Ls)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA ATGGGAGACCATAATGGGGATGAGTTTCTTGAGCTACCAATTGCCAATGTTGGGAGAATAATGAAGAAGATACTTCCCCAAAAGGCCAAGATTTCAAAAGAAGCCAAGAAGACAATGCAAGAATGTGCAAATGAGTTCATTAGCTTTGTAACAAATGAAGCAGCACAAAGATGTCACCAAGAGAATCGAAGAACTCTCAATGGAGATGATATTTGTTGGGCTTTTGGTTCTTATGGCTTAGATAACTTTGCTGAAATTTCTTCCAAGTACTTGCTTAAGTTTAGGGAAGTTGAGAGAATCAAGGCTCATCAATATGAATGCAAAATTACTCAACAACTTCAAGAAGAAGAAGATGAAGATGATGAATGA MGDHNGDEFLELPIANVGRIMKKILPQKAKISKEAKKTMQECANEFISFVTNEAAQRCHQENRRTLNGDDICWAFGSYGLDNFAEISSKYLLKFREVERIKAHQYECKITQQLQEEEDEDDE
BLAST of Lsi06G001250 vs. Swiss-Prot
Match: NFYB4_ARATH (Nuclear transcription factor Y subunit B-4 OS=Arabidopsis thaliana GN=NFYB4 PE=1 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 2.7e-29 Identity = 61/93 (65.59%), Postives = 77/93 (82.80%), Query Frame = 1
BLAST of Lsi06G001250 vs. Swiss-Prot
Match: NFYB5_ARATH (Nuclear transcription factor Y subunit B-5 OS=Arabidopsis thaliana GN=NFYB5 PE=2 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 2.5e-27 Identity = 57/94 (60.64%), Postives = 73/94 (77.66%), Query Frame = 1
BLAST of Lsi06G001250 vs. Swiss-Prot
Match: NFYB2_ARATH (Nuclear transcription factor Y subunit B-2 OS=Arabidopsis thaliana GN=NFYB2 PE=2 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.6e-24 Identity = 52/87 (59.77%), Postives = 67/87 (77.01%), Query Frame = 1
BLAST of Lsi06G001250 vs. Swiss-Prot
Match: NFYB7_ARATH (Nuclear transcription factor Y subunit B-7 OS=Arabidopsis thaliana GN=NFYB7 PE=2 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 7.5e-24 Identity = 56/118 (47.46%), Postives = 82/118 (69.49%), Query Frame = 1
BLAST of Lsi06G001250 vs. Swiss-Prot
Match: NFYB3_ARATH (Nuclear transcription factor Y subunit B-3 OS=Arabidopsis thaliana GN=NFYB3 PE=2 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 7.5e-24 Identity = 51/87 (58.62%), Postives = 67/87 (77.01%), Query Frame = 1
BLAST of Lsi06G001250 vs. TrEMBL
Match: A0A0A0LW12_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G569510 PE=4 SV=1) HSP 1 Score: 173.3 bits (438), Expect = 1.8e-40 Identity = 85/101 (84.16%), Postives = 90/101 (89.11%), Query Frame = 1
BLAST of Lsi06G001250 vs. TrEMBL
Match: A0A0A0LZ17_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G569530 PE=4 SV=1) HSP 1 Score: 154.5 bits (389), Expect = 8.6e-35 Identity = 84/113 (74.34%), Postives = 92/113 (81.42%), Query Frame = 1
BLAST of Lsi06G001250 vs. TrEMBL
Match: K4B0W9_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 6.8e-32 Identity = 71/116 (61.21%), Postives = 92/116 (79.31%), Query Frame = 1
BLAST of Lsi06G001250 vs. TrEMBL
Match: A0A162B6P2_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_003339 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 9.8e-31 Identity = 67/93 (72.04%), Postives = 81/93 (87.10%), Query Frame = 1
BLAST of Lsi06G001250 vs. TrEMBL
Match: A0A061F331_THECC (Nuclear transcription factor Y subunit B-4 OS=Theobroma cacao GN=TCM_026629 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 2.2e-30 Identity = 69/109 (63.30%), Postives = 83/109 (76.15%), Query Frame = 1
BLAST of Lsi06G001250 vs. TAIR10
Match: AT1G09030.1 (AT1G09030.1 nuclear factor Y, subunit B4) HSP 1 Score: 129.4 bits (324), Expect = 1.5e-30 Identity = 61/93 (65.59%), Postives = 77/93 (82.80%), Query Frame = 1
BLAST of Lsi06G001250 vs. TAIR10
Match: AT2G47810.1 (AT2G47810.1 nuclear factor Y, subunit B5) HSP 1 Score: 122.9 bits (307), Expect = 1.4e-28 Identity = 57/94 (60.64%), Postives = 73/94 (77.66%), Query Frame = 1
BLAST of Lsi06G001250 vs. TAIR10
Match: AT5G47640.1 (AT5G47640.1 nuclear factor Y, subunit B2) HSP 1 Score: 112.8 bits (281), Expect = 1.4e-25 Identity = 52/87 (59.77%), Postives = 67/87 (77.01%), Query Frame = 1
BLAST of Lsi06G001250 vs. TAIR10
Match: AT2G13570.1 (AT2G13570.1 nuclear factor Y, subunit B7) HSP 1 Score: 111.3 bits (277), Expect = 4.2e-25 Identity = 56/118 (47.46%), Postives = 82/118 (69.49%), Query Frame = 1
BLAST of Lsi06G001250 vs. TAIR10
Match: AT4G14540.1 (AT4G14540.1 nuclear factor Y, subunit B3) HSP 1 Score: 111.3 bits (277), Expect = 4.2e-25 Identity = 51/87 (58.62%), Postives = 67/87 (77.01%), Query Frame = 1
BLAST of Lsi06G001250 vs. NCBI nr
Match: gi|659100537|ref|XP_008451142.1| (PREDICTED: nuclear transcription factor Y subunit B-4 [Cucumis melo]) HSP 1 Score: 191.8 bits (486), Expect = 7.0e-46 Identity = 94/119 (78.99%), Postives = 107/119 (89.92%), Query Frame = 1
BLAST of Lsi06G001250 vs. NCBI nr
Match: gi|449435996|ref|XP_004135780.1| (PREDICTED: nuclear transcription factor Y subunit B-4-like [Cucumis sativus]) HSP 1 Score: 173.3 bits (438), Expect = 2.6e-40 Identity = 85/101 (84.16%), Postives = 90/101 (89.11%), Query Frame = 1
BLAST of Lsi06G001250 vs. NCBI nr
Match: gi|659100539|ref|XP_008451143.1| (PREDICTED: beta-galactosidase 15-like [Cucumis melo]) HSP 1 Score: 157.5 bits (397), Expect = 1.5e-35 Identity = 83/113 (73.45%), Postives = 88/113 (77.88%), Query Frame = 1
BLAST of Lsi06G001250 vs. NCBI nr
Match: gi|449435998|ref|XP_004135781.1| (PREDICTED: nuclear transcription factor Y subunit B-4-like [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 1.2e-34 Identity = 84/113 (74.34%), Postives = 92/113 (81.42%), Query Frame = 1
BLAST of Lsi06G001250 vs. NCBI nr
Match: gi|460370884|ref|XP_004231278.1| (PREDICTED: nuclear transcription factor Y subunit B-4-like [Solanum lycopersicum]) HSP 1 Score: 144.8 bits (364), Expect = 9.8e-32 Identity = 71/116 (61.21%), Postives = 92/116 (79.31%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Lagenaria siceraria
Date Performed: 2017-09-18
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|