Lsi05G002870 (gene) Bottle gourd (USVL1VR-Ls)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACGATGTTATAAAGATTACCTTAGTGAACTGAAGTTGTGATAATGGAAAAGAATAAACAGAAGTGCAGTAGATTGTAAACTATTCGAGGATCTAGAGGATCTAGACGAACAAGAGTTCTGAGCCAAGAGAGACAACGAGATAGGTAACGAGATATTTAAAACTGTGCAAGACATCAACAAAAAGTTAATTTCTATTGATTTAAAAAAGTGAGTCATTTTTCATTTTTGACCAGCCATATAACTTTCCCTTCTCACTTTACAATTTCTACTCCTTTGAAGCACCCCATGGCGGCAATTCCACTTCTAATACTTTTAGAATCTGAAATTCGGTTCCGGTAGTAAAGCCCTCGCTTAATTCCTCCTCTCAGACGGACTTTATACAGTAATTGGGACGTTTTGGACAATTATTCTGCATCTTCCGCTCCATCGCTGCCTCAATTCGGAGAGCTTGACACTACCAACATGCTTCTCCGCCAGCGAATCATCTTCTTGGGTTCTCAGGCAATCTCTCGAACTATTTCCTCATATTTCTGA ATGACGATCCATATAACTTTCCCTTCTCACTTTACAATTTCTACTCCTTTGAAGCACCCCATGGCGGCAATTCCACTTCTAATACTTTTAGAATCTGAAATTCGGTTCCGACGGACTTTATACAGTAATTGGGACGTTTTGGACAATTATTCTGCATCTTCCGCTCCATCGCTGCCTCAATTCGGAGAGCTTGACACTACCAACATGCTTCTCCGCCAGCGAATCATCTTCTTGGGTTCTCAGGCAATCTCTCGAACTATTTCCTCATATTTCTGA ATGACGATCCATATAACTTTCCCTTCTCACTTTACAATTTCTACTCCTTTGAAGCACCCCATGGCGGCAATTCCACTTCTAATACTTTTAGAATCTGAAATTCGGTTCCGACGGACTTTATACAGTAATTGGGACGTTTTGGACAATTATTCTGCATCTTCCGCTCCATCGCTGCCTCAATTCGGAGAGCTTGACACTACCAACATGCTTCTCCGCCAGCGAATCATCTTCTTGGGTTCTCAGGCAATCTCTCGAACTATTTCCTCATATTTCTGA MTIHITFPSHFTISTPLKHPMAAIPLLILLESEIRFRRTLYSNWDVLDNYSASSAPSLPQFGELDTTNMLLRQRIIFLGSQAISRTISSYF
BLAST of Lsi05G002870 vs. Swiss-Prot
Match: CLPP3_ARATH (ATP-dependent Clp protease proteolytic subunit 3, chloroplastic OS=Arabidopsis thaliana GN=CLPP3 PE=1 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.3e-08 Identity = 32/53 (60.38%), Postives = 35/53 (66.04%), Query Frame = 1
BLAST of Lsi05G002870 vs. TrEMBL
Match: A0A0A0LA84_CUCSA (ATP-dependent Clp protease proteolytic subunit OS=Cucumis sativus GN=Csa_3G363170 PE=3 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.4e-13 Identity = 50/92 (54.35%), Postives = 55/92 (59.78%), Query Frame = 1
BLAST of Lsi05G002870 vs. TrEMBL
Match: A0A067JRQ3_JATCU (ATP-dependent Clp protease proteolytic subunit OS=Jatropha curcas GN=JCGZ_02507 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 6.0e-09 Identity = 40/58 (68.97%), Postives = 44/58 (75.86%), Query Frame = 1
BLAST of Lsi05G002870 vs. TrEMBL
Match: B9H362_POPTR (ATP-dependent Clp protease proteolytic subunit OS=Populus trichocarpa GN=POPTR_0004s09110g PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.9e-08 Identity = 35/47 (74.47%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of Lsi05G002870 vs. TrEMBL
Match: A0A087HG17_ARAAL (ATP-dependent Clp protease proteolytic subunit OS=Arabis alpina GN=AALP_AA2G081700 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.1e-08 Identity = 35/58 (60.34%), Postives = 43/58 (74.14%), Query Frame = 1
BLAST of Lsi05G002870 vs. TrEMBL
Match: B9T322_RICCO (ATP-dependent Clp protease proteolytic subunit OS=Ricinus communis GN=RCOM_0326970 PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.1e-07 Identity = 34/52 (65.38%), Postives = 40/52 (76.92%), Query Frame = 1
BLAST of Lsi05G002870 vs. TAIR10
Match: AT1G66670.1 (AT1G66670.1 CLP protease proteolytic subunit 3) HSP 1 Score: 57.8 bits (138), Expect = 4.1e-09 Identity = 32/53 (60.38%), Postives = 35/53 (66.04%), Query Frame = 1
BLAST of Lsi05G002870 vs. NCBI nr
Match: gi|659114541|ref|XP_008457103.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 3, chloroplastic [Cucumis melo]) HSP 1 Score: 85.1 bits (209), Expect = 6.8e-14 Identity = 51/87 (58.62%), Postives = 55/87 (63.22%), Query Frame = 1
BLAST of Lsi05G002870 vs. NCBI nr
Match: gi|778680955|ref|XP_011651427.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 3, chloroplastic [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 3.4e-13 Identity = 50/92 (54.35%), Postives = 55/92 (59.78%), Query Frame = 1
BLAST of Lsi05G002870 vs. NCBI nr
Match: gi|1009118941|ref|XP_015876116.1| (PREDICTED: LOW QUALITY PROTEIN: ATP-dependent Clp protease proteolytic subunit 3, chloroplastic [Ziziphus jujuba]) HSP 1 Score: 73.9 bits (180), Expect = 1.6e-10 Identity = 44/79 (55.70%), Postives = 52/79 (65.82%), Query Frame = 1
BLAST of Lsi05G002870 vs. NCBI nr
Match: gi|802761955|ref|XP_012089922.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 3, chloroplastic [Jatropha curcas]) HSP 1 Score: 68.2 bits (165), Expect = 8.7e-09 Identity = 40/58 (68.97%), Postives = 44/58 (75.86%), Query Frame = 1
BLAST of Lsi05G002870 vs. NCBI nr
Match: gi|224079413|ref|XP_002305856.1| (hypothetical protein POPTR_0004s09110g [Populus trichocarpa]) HSP 1 Score: 65.5 bits (158), Expect = 5.6e-08 Identity = 35/47 (74.47%), Postives = 41/47 (87.23%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Lagenaria siceraria
Date Performed: 2017-09-18
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|