Lsi02G011490 (gene) Bottle gourd (USVL1VR-Ls)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGATAAGCAACGCCACCTTACAATAAAATCCATCTTTTTTAGACCAAAAGGACCATCCATTTGGACCACAAACATCATCAAATCATACTTCGACGAAGGCTTAACCAAAGAAGCTCGTAACCTGTTTGATGAAATGCCTGAAAGGGATGTGGTTGCCTGGACTACTATGATTGTTATCTTTACTTCTTGCAATCACTACCCTCAAGCGTGGGCTATGTTCTGTGAGATGTTAAGGAGTCAAATTGACCCAAATGCCTTCACTATGTCTAGTGTTCTCAAGGCTTGCATAGGCACGAAGGCTCTTTCATGTGGGGATTTGGCTCATAGTTTGGCCACAAAGCACAGTATTGACGGGTCGATGTACATCTGGAAAGCACTCTTGCACATGTATGCTACTTGCTGTGCTACCATGGGTGATGCATTGACTGTGTTTAATGATATACCTCTGAAGACTATTGTGTCATAG ATGGATAAGCAACGCCACCTTACAATAAAATCCATCTTTTTTAGACCAAAAGGACCATCCATTTGGACCACAAACATCATCAAATCATACTTCGACGAAGGCTTAACCAAAGAAGCTCGTAACCTGTTTGATGAAATGCCTGAAAGGGATGTGGTTGCCTGGACTACTATGATTGTTATCTTTACTTCTTGCAATCACTACCCTCAAGCGTGGGCTATGTTCTGTGAGATGTTAAGGAGTCAAATTGACCCAAATGCCTTCACTATGTCTAGTGTTCTCAAGGCTTGCATAGGCACGAAGGCTCTTTCATGTGGGGATTTGGCTCATAGTTTGGCCACAAAGCACAGTATTGACGGGTCGATGTACATCTGGAAAGCACTCTTGCACATGTATGCTACTTGCTGTGCTACCATGGGTGATGCATTGACTGTGTTTAATGATATACCTCTGAAGACTATTGTGTCATAG ATGGATAAGCAACGCCACCTTACAATAAAATCCATCTTTTTTAGACCAAAAGGACCATCCATTTGGACCACAAACATCATCAAATCATACTTCGACGAAGGCTTAACCAAAGAAGCTCGTAACCTGTTTGATGAAATGCCTGAAAGGGATGTGGTTGCCTGGACTACTATGATTGTTATCTTTACTTCTTGCAATCACTACCCTCAAGCGTGGGCTATGTTCTGTGAGATGTTAAGGAGTCAAATTGACCCAAATGCCTTCACTATGTCTAGTGTTCTCAAGGCTTGCATAGGCACGAAGGCTCTTTCATGTGGGGATTTGGCTCATAGTTTGGCCACAAAGCACAGTATTGACGGGTCGATGTACATCTGGAAAGCACTCTTGCACATGTATGCTACTTGCTGTGCTACCATGGGTGATGCATTGACTGTGTTTAATGATATACCTCTGAAGACTATTGTGTCATAG MDKQRHLTIKSIFFRPKGPSIWTTNIIKSYFDEGLTKEARNLFDEMPERDVVAWTTMIVIFTSCNHYPQAWAMFCEMLRSQIDPNAFTMSSVLKACIGTKALSCGDLAHSLATKHSIDGSMYIWKALLHMYATCCATMGDALTVFNDIPLKTIVS
BLAST of Lsi02G011490 vs. Swiss-Prot
Match: PPR83_ARATH (Putative pentatricopeptide repeat-containing protein At1g56570 OS=Arabidopsis thaliana GN=PCMP-E64 PE=3 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 3.5e-34 Identity = 69/142 (48.59%), Postives = 96/142 (67.61%), Query Frame = 1
BLAST of Lsi02G011490 vs. Swiss-Prot
Match: PP319_ARATH (Pentatricopeptide repeat-containing protein At4g18520 OS=Arabidopsis thaliana GN=PCMP-A2 PE=2 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 9.2e-19 Identity = 48/132 (36.36%), Postives = 79/132 (59.85%), Query Frame = 1
BLAST of Lsi02G011490 vs. Swiss-Prot
Match: PP244_ARATH (Pentatricopeptide repeat-containing protein At3g20730 OS=Arabidopsis thaliana GN=PCMP-E94 PE=2 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 8.6e-17 Identity = 49/130 (37.69%), Postives = 70/130 (53.85%), Query Frame = 1
BLAST of Lsi02G011490 vs. Swiss-Prot
Match: PP227_ARATH (Putative pentatricopeptide repeat-containing protein At3g13770, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H85 PE=3 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 8.6e-17 Identity = 44/119 (36.97%), Postives = 69/119 (57.98%), Query Frame = 1
BLAST of Lsi02G011490 vs. Swiss-Prot
Match: PP255_ARATH (Putative pentatricopeptide repeat-containing protein At3g25970 OS=Arabidopsis thaliana GN=PCMP-E46 PE=3 SV=2) HSP 1 Score: 87.4 bits (215), Expect = 1.5e-16 Identity = 48/133 (36.09%), Postives = 67/133 (50.38%), Query Frame = 1
BLAST of Lsi02G011490 vs. TrEMBL
Match: A0A0A0LW37_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G555630 PE=4 SV=1) HSP 1 Score: 227.6 bits (579), Expect = 1.0e-56 Identity = 108/142 (76.06%), Postives = 120/142 (84.51%), Query Frame = 1
BLAST of Lsi02G011490 vs. TrEMBL
Match: F6I4U5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_14s0060g00870 PE=4 SV=1) HSP 1 Score: 185.7 bits (470), Expect = 4.4e-44 Identity = 88/142 (61.97%), Postives = 104/142 (73.24%), Query Frame = 1
BLAST of Lsi02G011490 vs. TrEMBL
Match: M5W7M0_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa026465mg PE=4 SV=1) HSP 1 Score: 181.8 bits (460), Expect = 6.4e-43 Identity = 87/139 (62.59%), Postives = 105/139 (75.54%), Query Frame = 1
BLAST of Lsi02G011490 vs. TrEMBL
Match: A0A067GPR6_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g007288mg PE=4 SV=1) HSP 1 Score: 176.0 bits (445), Expect = 3.5e-41 Identity = 83/140 (59.29%), Postives = 107/140 (76.43%), Query Frame = 1
BLAST of Lsi02G011490 vs. TrEMBL
Match: V4V4G6_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10000630mg PE=4 SV=1) HSP 1 Score: 176.0 bits (445), Expect = 3.5e-41 Identity = 83/140 (59.29%), Postives = 107/140 (76.43%), Query Frame = 1
BLAST of Lsi02G011490 vs. TAIR10
Match: AT1G56570.1 (AT1G56570.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 146.0 bits (367), Expect = 2.0e-35 Identity = 69/142 (48.59%), Postives = 96/142 (67.61%), Query Frame = 1
BLAST of Lsi02G011490 vs. TAIR10
Match: AT4G18520.1 (AT4G18520.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 94.7 bits (234), Expect = 5.2e-20 Identity = 48/132 (36.36%), Postives = 79/132 (59.85%), Query Frame = 1
BLAST of Lsi02G011490 vs. TAIR10
Match: AT3G20730.1 (AT3G20730.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 88.2 bits (217), Expect = 4.9e-18 Identity = 49/130 (37.69%), Postives = 70/130 (53.85%), Query Frame = 1
BLAST of Lsi02G011490 vs. TAIR10
Match: AT3G13770.1 (AT3G13770.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 88.2 bits (217), Expect = 4.9e-18 Identity = 44/119 (36.97%), Postives = 69/119 (57.98%), Query Frame = 1
BLAST of Lsi02G011490 vs. TAIR10
Match: AT3G25970.1 (AT3G25970.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 87.4 bits (215), Expect = 8.3e-18 Identity = 48/133 (36.09%), Postives = 67/133 (50.38%), Query Frame = 1
BLAST of Lsi02G011490 vs. NCBI nr
Match: gi|778662137|ref|XP_011659402.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g56570 [Cucumis sativus]) HSP 1 Score: 227.6 bits (579), Expect = 1.5e-56 Identity = 108/142 (76.06%), Postives = 120/142 (84.51%), Query Frame = 1
BLAST of Lsi02G011490 vs. NCBI nr
Match: gi|659099292|ref|XP_008450526.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g56570 [Cucumis melo]) HSP 1 Score: 227.3 bits (578), Expect = 1.9e-56 Identity = 109/142 (76.76%), Postives = 119/142 (83.80%), Query Frame = 1
BLAST of Lsi02G011490 vs. NCBI nr
Match: gi|694419390|ref|XP_009337652.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g56570 [Pyrus x bretschneideri]) HSP 1 Score: 187.6 bits (475), Expect = 1.7e-44 Identity = 89/142 (62.68%), Postives = 108/142 (76.06%), Query Frame = 1
BLAST of Lsi02G011490 vs. NCBI nr
Match: gi|645221981|ref|XP_008246376.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g56570 [Prunus mume]) HSP 1 Score: 186.4 bits (472), Expect = 3.7e-44 Identity = 89/142 (62.68%), Postives = 106/142 (74.65%), Query Frame = 1
BLAST of Lsi02G011490 vs. NCBI nr
Match: gi|225450537|ref|XP_002277327.1| (PREDICTED: putative pentatricopeptide repeat-containing protein At1g56570 isoform X2 [Vitis vinifera]) HSP 1 Score: 185.7 bits (470), Expect = 6.3e-44 Identity = 88/142 (61.97%), Postives = 104/142 (73.24%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Lagenaria siceraria
Date Performed: 2017-09-18
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |