Cucsa.341130 (gene) Cucumber (Gy14) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.AAATTAAATATAATAAAAATTTTCCGACACGGCTATGCATGGCCCCCGAAGGAGCCGTTCCCAGTCCGTCCCCCGGTCGGCACGCGACGACCTGCTCTCGCCGCGGAAGCAGCTCGAGCAGTCCACCAACAGCCGATGGGTTCGGGACTGGGACCCCCGTGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACAGATCCATTTTGCTGACTTCCCTTACCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGTCGAGAGAAGTTAAATATATTAAAAAAATGATAGATTTTTAA aaattaaatataataaaaattttccgacacggctatgcatggcccccgaaggagccgttcccagtccgtcccccggtcggcacgcgacgacctgctctcgccgcggaagcagctcgagcagtccaccaacagccgatgggttcgggactgggacccccgtgcccagccctcagagccaatccttttcccgaggttacagatccattttgctgacttcccttacctacattgttccatcgaccagaggctgttcaccttggagacctgatgcgTCGAGAGAAGTTAAATATATTAAAAAAATGAtagatttttaa AAATTAAATATAATAAAAATTTTCCGACACGGCTATGCATGGCCCCCGAAGGAGCCGTTCCCAGTCCGTCCCCCGGTCGGCACGCGACGACCTGCTCTCGCCGCGGAAGCAGCTCGAGCAGTCCACCAACAGCCGATGGGTTCGGGACTGGGACCCCCGTGCCCAGCCCTCAGAGCCAATCCTTTTCCCGAGGTTACAGATCCATTTTGCTGACTTCCCTTACCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGTCGAGAGAAGTTAAATATATTAAAAAAATGATAGATTTTTAA IKYNKNFPTRLCMAPEGAVPSPSPGRHATTCSRRGSSSSSPPTADGFGTGTPVPSPQSQSFSRGYRSILLTSLTYIVPSTRGCSPWRPDASREVKYIKKMIDF*
BLAST of Cucsa.341130 vs. TrEMBL
Match: A0A0R0GS22_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G022600 PE=4 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 1.2e-32 Identity = 70/83 (84.34%), Postives = 73/83 (87.95%), Query Frame = 1
BLAST of Cucsa.341130 vs. TrEMBL
Match: M1BN49_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG401019042 PE=4 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 2.6e-32 Identity = 70/77 (90.91%), Postives = 70/77 (90.91%), Query Frame = 1
BLAST of Cucsa.341130 vs. TrEMBL
Match: I1LXS9_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
BLAST of Cucsa.341130 vs. TrEMBL
Match: I1LXS9_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 2 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 3 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 4 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 5 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 6 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 7 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 8 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 9 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 10 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 11 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 12 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 13 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 14 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 15 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
HSP 16 Score: 144.4 bits (363), Expect = 7.6e-32 Identity = 69/76 (90.79%), Postives = 70/76 (92.11%), Query Frame = 1
HSP 17 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 70/82 (85.37%), Postives = 72/82 (87.80%), Query Frame = 1
BLAST of Cucsa.341130 vs. TrEMBL
Match: A0A0R0GPA8_SOYBN (Uncharacterized protein (Fragment) OS=Glycine max GN=GLYMA_13G023800 PE=4 SV=1) HSP 1 Score: 144.8 bits (364), Expect = 5.8e-32 Identity = 69/77 (89.61%), Postives = 71/77 (92.21%), Query Frame = 1
BLAST of Cucsa.341130 vs. NCBI nr
Match: gi|947068970|gb|KRH17861.1| (hypothetical protein GLYMA_13G022600 [Glycine max]) HSP 1 Score: 147.1 bits (370), Expect = 1.7e-32 Identity = 70/83 (84.34%), Postives = 73/83 (87.95%), Query Frame = 1
BLAST of Cucsa.341130 vs. NCBI nr
Match: gi|947068983|gb|KRH17874.1| (hypothetical protein GLYMA_13G023800, partial [Glycine max]) HSP 1 Score: 144.8 bits (364), Expect = 8.3e-32 Identity = 69/77 (89.61%), Postives = 71/77 (92.21%), Query Frame = 1
BLAST of Cucsa.341130 vs. NCBI nr
Match: gi|947068982|gb|KRH17873.1| (hypothetical protein GLYMA_13G023700, partial [Glycine max]) HSP 1 Score: 144.8 bits (364), Expect = 8.3e-32 Identity = 69/77 (89.61%), Postives = 71/77 (92.21%), Query Frame = 1
BLAST of Cucsa.341130 vs. NCBI nr
Match: gi|947068981|gb|KRH17872.1| (hypothetical protein GLYMA_13G023600, partial [Glycine max]) HSP 1 Score: 144.4 bits (363), Expect = 1.1e-31 Identity = 69/76 (90.79%), Postives = 70/76 (92.11%), Query Frame = 1
BLAST of Cucsa.341130 vs. NCBI nr
Match: gi|947068858|gb|KRH17749.1| (hypothetical protein GLYMA_13G012400 [Glycine max]) HSP 1 Score: 144.4 bits (363), Expect = 1.1e-31 Identity = 69/76 (90.79%), Postives = 70/76 (92.11%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Gy14)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |