CsaV3_1G016980 (gene) Cucumber (Chinese Long) v3
The following sequences are available for this feature:
Legend: exonpolypeptideCDS Hold the cursor over a type above to highlight its positions in the sequence below.GAGATTCTGTTGATTGGTTTTTGTTCACGAGAGGATTTGAAGGGATTTTTTTGTGTGTAGAAGATAGATGGGGGAAAAATTAGATAAAACAGTTTTAAGTGTTGAATGTAATGTTTTGTCATGTTCGAAGATGAATGTTGGAGATGGGAAGTTTTGGGGGTTTTCCTCCTCTTTCCCTGTTGTTCTAAGAATTGTGTTGCTATTACTTTTCTGACTGTGTAAATATTTTGTTGCTGGTAAAAGTTTTCACTGTTAAGGTTCTGTTGCATTCGTTCTTATGTTTCGTTTTAATTTTTTTTTCTTTTCTTTTCCAGAGATGTGATATGTCCGAGTCTTTGAGGCATGTGAACGGGAAACCAACAATTCCAATTGTTACTGAACGGACGTTGCCCAAGTTCTTGGAGTCAGCTCGCATGGAGAACAGAGTTAATAGAAGTAGTACACGTTTGAAATTGTTTTCTGGGTCTGCAAATCGTTTACTTTCTCAG ATGTCCGAGTCTTTGAGGCATGTGAACGGGAAACCAACAATTCCAATTGTTACTGAACGGACGTTGCCCAAGTTCTTGGAGTCAGCTCGCATGGAGAACAGAGTTAATAGAAGTAGTACACGTTTGAAATTGTTTTCTGGGTCTGCAAATCGTTTACTTTCTCAG ATGTCCGAGTCTTTGAGGCATGTGAACGGGAAACCAACAATTCCAATTGTTACTGAACGGACGTTGCCCAAGTTCTTGGAGTCAGCTCGCATGGAGAACAGAGTTAATAGAAGTAGTACACGTTTGAAATTGTTTTCTGGGTCTGCAAATCGTTTACTTTCTCAG MSESLRHVNGKPTIPIVTERTLPKFLESARMENRVNRSSTRLKLFSGSANRLLSQ
BLAST of CsaV3_1G016980 vs. NCBI nr
Match: XP_004148496.1 (PREDICTED: ribose-phosphate pyrophosphokinase 1 [Cucumis sativus] >KGN60421.1 hypothetical protein Csa_3G904100 [Cucumis sativus]) HSP 1 Score: 107.1 bits (266), Expect = 2.0e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. NCBI nr
Match: XP_008465941.1 (PREDICTED: ribose-phosphate pyrophosphokinase 1-like [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 4.9e-19 Identity = 53/55 (96.36%), Postives = 53/55 (96.36%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. NCBI nr
Match: XP_022159419.1 (ribose-phosphate pyrophosphokinase 1 isoform X1 [Momordica charantia]) HSP 1 Score: 98.6 bits (244), Expect = 7.0e-18 Identity = 49/55 (89.09%), Postives = 53/55 (96.36%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. NCBI nr
Match: XP_022952810.1 (ribose-phosphate pyrophosphokinase 1 isoform X1 [Cucurbita moschata] >XP_022971980.1 ribose-phosphate pyrophosphokinase 1 isoform X1 [Cucurbita maxima] >XP_023553898.1 ribose-phosphate pyrophosphokinase 1 isoform X1 [Cucurbita pepo subsp. pepo]) HSP 1 Score: 98.6 bits (244), Expect = 7.0e-18 Identity = 50/55 (90.91%), Postives = 53/55 (96.36%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. NCBI nr
Match: POE76309.1 (ribose-phosphate pyrophosphokinase 1, chloroplastic [Quercus suber]) HSP 1 Score: 82.0 bits (201), Expect = 6.8e-13 Identity = 40/55 (72.73%), Postives = 49/55 (89.09%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TAIR10
Match: AT2G35390.2 (Phosphoribosyltransferase family protein) HSP 1 Score: 76.6 bits (187), Expect = 5.2e-15 Identity = 39/55 (70.91%), Postives = 45/55 (81.82%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TAIR10
Match: AT1G32380.1 (phosphoribosyl pyrophosphate (PRPP) synthase 2) HSP 1 Score: 57.8 bits (138), Expect = 2.5e-09 Identity = 26/48 (54.17%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. Swiss-Prot
Match: sp|Q42581|KPRS1_ARATH (Ribose-phosphate pyrophosphokinase 1, chloroplastic OS=Arabidopsis thaliana OX=3702 GN=PRS1 PE=2 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 9.4e-14 Identity = 39/55 (70.91%), Postives = 45/55 (81.82%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. Swiss-Prot
Match: sp|Q9XG99|KPRS2_SPIOL (Ribose-phosphate pyrophosphokinase 2, chloroplastic OS=Spinacia oleracea OX=3562 GN=PRS2 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 5.7e-11 Identity = 33/53 (62.26%), Postives = 44/53 (83.02%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. Swiss-Prot
Match: sp|Q42583|KPRS2_ARATH (Ribose-phosphate pyrophosphokinase 2, chloroplastic OS=Arabidopsis thaliana OX=3702 GN=PRS2 PE=2 SV=2) HSP 1 Score: 57.8 bits (138), Expect = 4.5e-08 Identity = 26/48 (54.17%), Postives = 38/48 (79.17%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TrEMBL
Match: tr|A0A0A0LK92|A0A0A0LK92_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G904100 PE=3 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.3e-20 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TrEMBL
Match: tr|A0A1S3CQ25|A0A1S3CQ25_CUCME (ribose-phosphate pyrophosphokinase 1-like OS=Cucumis melo OX=3656 GN=LOC103503511 PE=3 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 53/55 (96.36%), Postives = 53/55 (96.36%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TrEMBL
Match: tr|A0A2P4J6G0|A0A2P4J6G0_QUESU (Ribose-phosphate pyrophosphokinase OS=Quercus suber OX=58331 GN=CFP56_25677 PE=3 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.5e-13 Identity = 40/55 (72.73%), Postives = 49/55 (89.09%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TrEMBL
Match: tr|A0A2N9HU06|A0A2N9HU06_FAGSY (Uncharacterized protein OS=Fagus sylvatica OX=28930 GN=FSB_LOCUS45389 PE=3 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 2.2e-12 Identity = 39/55 (70.91%), Postives = 47/55 (85.45%), Query Frame = 0
BLAST of CsaV3_1G016980 vs. TrEMBL
Match: tr|A0A067K353|A0A067K353_JATCU (Uncharacterized protein OS=Jatropha curcas OX=180498 GN=JCGZ_16216 PE=3 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.8e-12 Identity = 41/55 (74.55%), Postives = 46/55 (83.64%), Query Frame = 0
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |