Csa4G618550 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAGAAATTTGAGTTGGTTTTCATACCAATGCCAGGATCCGGTCACATCATTTCCATGGTCGAGATGGCAAATATTCTCCTCGCTCGAGATCATCGTCTCGCTGTCACAATGATTGCCATTAAGCTATACCCTTGGATCTCAAAGCTAATGAATATATCCAATCACTTTCTGCACAGCCTCGTAATACCAGCAACAGAAACAATACATCCATATACGATTTATTGTTCTTCCTGCATTACCTGCTATACCAAACAATGGGAACCGTTTCTTCCTGGAAATAGTTCTTGA ATGAAGAAATTTGAGTTGGTTTTCATACCAATGCCAGGATCCGGTCACATCATTTCCATGGTCGAGATGGCAAATATTCTCCTCGCTCGAGATCATCGTCTCGCTGTCACAATGATTGCCATTAAGCTATACCCTTGGATCTCAAAGCTAATGAATATATCCAATCACTTTCTGCACAGCCTCGTAATACCAGCAACAGAAACAATACATCCATATACGATTTATTGTTCTTCCTGCATTACCTGCTATACCAAACAATGGGAACCGTTTCTTCCTGGAAATAGTTCTTGA ATGAAGAAATTTGAGTTGGTTTTCATACCAATGCCAGGATCCGGTCACATCATTTCCATGGTCGAGATGGCAAATATTCTCCTCGCTCGAGATCATCGTCTCGCTGTCACAATGATTGCCATTAAGCTATACCCTTGGATCTCAAAGCTAATGAATATATCCAATCACTTTCTGCACAGCCTCGTAATACCAGCAACAGAAACAATACATCCATATACGATTTATTGTTCTTCCTGCATTACCTGCTATACCAAACAATGGGAACCGTTTCTTCCTGGAAATAGTTCTTGA MKKFELVFIPMPGSGHIISMVEMANILLARDHRLAVTMIAIKLYPWISKLMNISNHFLHSLVIPATETIHPYTIYCSSCITCYTKQWEPFLPGNSS*
BLAST of Csa4G618550 vs. Swiss-Prot
Match: U7A16_PYRCO (UDP-glycosyltransferase 71A16 OS=Pyrus communis GN=UGT71A16 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.6e-06 Identity = 25/57 (43.86%), Postives = 35/57 (61.40%), Query Frame = 1
BLAST of Csa4G618550 vs. Swiss-Prot
Match: U7A15_MALDO (UDP-glycosyltransferase 71A15 OS=Malus domestica GN=UGT71A15 PE=1 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 5.6e-06 Identity = 25/57 (43.86%), Postives = 34/57 (59.65%), Query Frame = 1
BLAST of Csa4G618550 vs. Swiss-Prot
Match: U71E1_STERE (UDP-glycosyltransferase 71E1 OS=Stevia rebaudiana GN=UGT71E1 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 7.3e-06 Identity = 24/44 (54.55%), Postives = 30/44 (68.18%), Query Frame = 1
BLAST of Csa4G618550 vs. Swiss-Prot
Match: U71K2_PYRCO (UDP-glycosyltransferase 71K2 OS=Pyrus communis GN=UGT71K2 PE=1 SV=1) HSP 1 Score: 50.8 bits (120), Expect = 9.5e-06 Identity = 21/44 (47.73%), Postives = 32/44 (72.73%), Query Frame = 1
BLAST of Csa4G618550 vs. TrEMBL
Match: A0A0A0KZA7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G618550 PE=4 SV=1) HSP 1 Score: 202.6 bits (514), Expect = 2.2e-49 Identity = 96/96 (100.00%), Postives = 96/96 (100.00%), Query Frame = 1
BLAST of Csa4G618550 vs. TrEMBL
Match: A0A0A0L341_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G620550 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 6.2e-12 Identity = 38/43 (88.37%), Postives = 40/43 (93.02%), Query Frame = 1
BLAST of Csa4G618550 vs. TrEMBL
Match: K7NBW4_SIRGR (Glycosyltransferase OS=Siraitia grosvenorii GN=UDPG7 PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 9.3e-08 Identity = 30/43 (69.77%), Postives = 36/43 (83.72%), Query Frame = 1
BLAST of Csa4G618550 vs. TrEMBL
Match: A0A0A0L321_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618520 PE=3 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.7e-07 Identity = 29/43 (67.44%), Postives = 37/43 (86.05%), Query Frame = 1
BLAST of Csa4G618550 vs. TrEMBL
Match: A0A0A0L1T2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G618540 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.7e-07 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of Csa4G618550 vs. TAIR10
Match: AT3G21790.1 (AT3G21790.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 50.4 bits (119), Expect = 7.0e-07 Identity = 34/82 (41.46%), Postives = 46/82 (56.10%), Query Frame = 1
BLAST of Csa4G618550 vs. NCBI nr
Match: gi|700199832|gb|KGN54990.1| (hypothetical protein Csa_4G618550 [Cucumis sativus]) HSP 1 Score: 202.6 bits (514), Expect = 3.1e-49 Identity = 96/96 (100.00%), Postives = 96/96 (100.00%), Query Frame = 1
BLAST of Csa4G618550 vs. NCBI nr
Match: gi|449456659|ref|XP_004146066.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2 [Cucumis sativus]) HSP 1 Score: 78.2 bits (191), Expect = 8.9e-12 Identity = 38/43 (88.37%), Postives = 40/43 (93.02%), Query Frame = 1
BLAST of Csa4G618550 vs. NCBI nr
Match: gi|659129340|ref|XP_008464637.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis melo]) HSP 1 Score: 77.8 bits (190), Expect = 1.2e-11 Identity = 43/61 (70.49%), Postives = 49/61 (80.33%), Query Frame = 1
BLAST of Csa4G618550 vs. NCBI nr
Match: gi|343466221|gb|AEM43004.1| (UDP-glucosyltransferase [Siraitia grosvenorii]) HSP 1 Score: 64.3 bits (155), Expect = 1.3e-07 Identity = 30/43 (69.77%), Postives = 36/43 (83.72%), Query Frame = 1
BLAST of Csa4G618550 vs. NCBI nr
Match: gi|700199831|gb|KGN54989.1| (hypothetical protein Csa_4G618540 [Cucumis sativus]) HSP 1 Score: 62.8 bits (151), Expect = 3.9e-07 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|