Csa4G188960 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGA ATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGA ATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGGAGGATGA MEDGGWRMEDGGWRMEDGGWRMEDGGWRMEDGGWRMEDGGWRMEDGGWRMEDGG*
BLAST of Csa4G188960 vs. Swiss-Prot
Match: EIF3A_DROPE (Eukaryotic translation initiation factor 3 subunit A OS=Drosophila persimilis GN=eIF3-S10 PE=3 SV=2) HSP 1 Score: 59.7 bits (143), Expect = 1.2e-08 Identity = 33/53 (62.26%), Postives = 35/53 (66.04%), Query Frame = 1
HSP 2 Score: 58.9 bits (141), Expect = 2.0e-08 Identity = 33/53 (62.26%), Postives = 35/53 (66.04%), Query Frame = 1
BLAST of Csa4G188960 vs. Swiss-Prot
Match: Y0266_DICDI (Uncharacterized protein DDB_G0290685 OS=Dictyostelium discoideum GN=DDB_G0290685 PE=2 SV=2) HSP 1 Score: 50.4 bits (119), Expect = 7.1e-06 Identity = 23/53 (43.40%), Postives = 29/53 (54.72%), Query Frame = 1
HSP 2 Score: 48.1 bits (113), Expect = 3.5e-05 Identity = 22/52 (42.31%), Postives = 28/52 (53.85%), Query Frame = 1
HSP 3 Score: 48.1 bits (113), Expect = 3.5e-05 Identity = 23/53 (43.40%), Postives = 30/53 (56.60%), Query Frame = 1
HSP 4 Score: 41.2 bits (95), Expect = 4.3e-03 Identity = 21/53 (39.62%), Postives = 27/53 (50.94%), Query Frame = 1
HSP 5 Score: 41.2 bits (95), Expect = 4.3e-03 Identity = 21/53 (39.62%), Postives = 27/53 (50.94%), Query Frame = 1
HSP 6 Score: 40.4 bits (93), Expect = 7.3e-03 Identity = 19/52 (36.54%), Postives = 25/52 (48.08%), Query Frame = 1
HSP 7 Score: 38.9 bits (89), Expect = 2.1e-02 Identity = 20/52 (38.46%), Postives = 26/52 (50.00%), Query Frame = 1
HSP 8 Score: 38.9 bits (89), Expect = 2.1e-02 Identity = 20/52 (38.46%), Postives = 26/52 (50.00%), Query Frame = 1
BLAST of Csa4G188960 vs. TrEMBL
Match: A0A0A0KZX8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G188960 PE=4 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 5.4e-29 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = 1
BLAST of Csa4G188960 vs. TrEMBL
Match: A7EQQ0_SCLS1 (Uncharacterized protein OS=Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1) GN=SS1G_07653 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 9.6e-18 Identity = 39/53 (73.58%), Postives = 46/53 (86.79%), Query Frame = 1
BLAST of Csa4G188960 vs. TrEMBL
Match: A7EQQ0_SCLS1 (Uncharacterized protein OS=Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1) GN=SS1G_07653 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.6e-17 Identity = 38/53 (71.70%), Postives = 46/53 (86.79%), Query Frame = 1
HSP 2 Score: 94.4 bits (233), Expect = 4.7e-17 Identity = 38/52 (73.08%), Postives = 45/52 (86.54%), Query Frame = 1
HSP 3 Score: 84.7 bits (208), Expect = 3.8e-14 Identity = 31/53 (58.49%), Postives = 39/53 (73.58%), Query Frame = 1
BLAST of Csa4G188960 vs. TrEMBL
Match: B4I746_DROSE (GM22956 OS=Drosophila sechellia GN=Dsec\GM22956 PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 1.9e-13 Identity = 30/54 (55.56%), Postives = 39/54 (72.22%), Query Frame = 1
HSP 2 Score: 84.3 bits (207), Expect = 4.9e-14 Identity = 33/56 (58.93%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of Csa4G188960 vs. TrEMBL
Match: A0A0C9TEH6_9HOMO (Unplaced genomic scaffold SPHSTscaffold_251, whole genome shotgun sequence (Fragment) OS=Sphaerobolus stellatus SS14 GN=M422DRAFT_190636 PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 4.2e-13 Identity = 31/56 (55.36%), Postives = 40/56 (71.43%), Query Frame = 1
HSP 2 Score: 79.0 bits (193), Expect = 2.1e-12 Identity = 32/65 (49.23%), Postives = 41/65 (63.08%), Query Frame = 1
HSP 3 Score: 81.6 bits (200), Expect = 3.2e-13 Identity = 32/54 (59.26%), Postives = 40/54 (74.07%), Query Frame = 1
BLAST of Csa4G188960 vs. NCBI nr
Match: gi|700198764|gb|KGN53922.1| (hypothetical protein Csa_4G188960 [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 7.8e-29 Identity = 54/54 (100.00%), Postives = 54/54 (100.00%), Query Frame = 1
BLAST of Csa4G188960 vs. NCBI nr
Match: gi|156050133|ref|XP_001591028.1| (hypothetical protein SS1G_07653 [Sclerotinia sclerotiorum 1980]) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 39/53 (73.58%), Postives = 46/53 (86.79%), Query Frame = 1
BLAST of Csa4G188960 vs. NCBI nr
Match: gi|156050133|ref|XP_001591028.1| (hypothetical protein SS1G_07653 [Sclerotinia sclerotiorum 1980]) HSP 1 Score: 94.7 bits (234), Expect = 5.2e-17 Identity = 38/53 (71.70%), Postives = 46/53 (86.79%), Query Frame = 1
HSP 2 Score: 94.4 bits (233), Expect = 6.8e-17 Identity = 38/52 (73.08%), Postives = 45/52 (86.54%), Query Frame = 1
HSP 3 Score: 87.8 bits (216), Expect = 6.4e-15 Identity = 33/54 (61.11%), Postives = 41/54 (75.93%), Query Frame = 1
BLAST of Csa4G188960 vs. NCBI nr
Match: gi|749880742|gb|KIJ50300.1| (hypothetical protein M422DRAFT_114494, partial [Sphaerobolus stellatus SS14]) HSP 1 Score: 87.0 bits (214), Expect = 1.1e-14 Identity = 32/53 (60.38%), Postives = 40/53 (75.47%), Query Frame = 1
HSP 2 Score: 84.7 bits (208), Expect = 5.4e-14 Identity = 31/53 (58.49%), Postives = 39/53 (73.58%), Query Frame = 1
BLAST of Csa4G188960 vs. NCBI nr
Match: gi|195345691|ref|XP_002039402.1| (GM22956 [Drosophila sechellia]) HSP 1 Score: 82.4 bits (202), Expect = 2.7e-13 Identity = 30/54 (55.56%), Postives = 39/54 (72.22%), Query Frame = 1
HSP 2 Score: 84.3 bits (207), Expect = 7.1e-14 Identity = 33/56 (58.93%), Postives = 42/56 (75.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|