Csa3G321320 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGATTTCACACCTCAAAAAACATGCCATCATCTGTATCTTTTCATTTGTTGAAAGGTTTGTTGCTGAGGTATTCCATGATTTATGCGAAGAGGTCATTTCAACAGCTGCAAGAGGCCATAGTCTTATGATTCAGGTGCAACAACTTGAGGAAGAGGTTCCTTCAATTGAGAAAGCATTTATGTCCCAGGCAAATCATACATCTTTCTTCACTGGTACAGGTTCGTCCATCACATATATTGTTATATTTTTGCCAACAATCATGGTCACAACATTGTTTATATTGATGGATTTGAACAATTAA ATGGAGATTTCACACCTCAAAAAACATGCCATCATCTGTATCTTTTCATTTGTTGAAAGGTTTGTTGCTGAGGTATTCCATGATTTATGCGAAGAGGTCATTTCAACAGCTGCAAGAGGCCATAGTCTTATGATTCAGGTGCAACAACTTGAGGAAGAGGTTCCTTCAATTGAGAAAGCATTTATGTCCCAGGCAAATCATACATCTTTCTTCACTGGTACAGGTTCGTCCATCACATATATTGTTATATTTTTGCCAACAATCATGGTCACAACATTGTTTATATTGATGGATTTGAACAATTAA ATGGAGATTTCACACCTCAAAAAACATGCCATCATCTGTATCTTTTCATTTGTTGAAAGGTTTGTTGCTGAGGTATTCCATGATTTATGCGAAGAGGTCATTTCAACAGCTGCAAGAGGCCATAGTCTTATGATTCAGGTGCAACAACTTGAGGAAGAGGTTCCTTCAATTGAGAAAGCATTTATGTCCCAGGCAAATCATACATCTTTCTTCACTGGTACAGGTTCGTCCATCACATATATTGTTATATTTTTGCCAACAATCATGGTCACAACATTGTTTATATTGATGGATTTGAACAATTAA MEISHLKKHAIICIFSFVERFVAEVFHDLCEEVISTAARGHSLMIQVQQLEEEVPSIEKAFMSQANHTSFFTGTGSSITYIVIFLPTIMVTTLFILMDLNN*
BLAST of Csa3G321320 vs. Swiss-Prot
Match: SCAR2_ARATH (Protein SCAR2 OS=Arabidopsis thaliana GN=SCAR2 PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 7.2e-12 Identity = 33/55 (60.00%), Postives = 40/55 (72.73%), Query Frame = 1
BLAST of Csa3G321320 vs. Swiss-Prot
Match: SCRL1_ORYSJ (SCAR-like protein 1 OS=Oryza sativa subsp. japonica GN=Os03g0816900 PE=2 SV=2) HSP 1 Score: 67.0 bits (162), Expect = 1.4e-10 Identity = 27/50 (54.00%), Postives = 42/50 (84.00%), Query Frame = 1
BLAST of Csa3G321320 vs. Swiss-Prot
Match: SCAR4_ARATH (Protein SCAR4 OS=Arabidopsis thaliana GN=SCAR4 PE=1 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-08 Identity = 27/58 (46.55%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of Csa3G321320 vs. Swiss-Prot
Match: SCRL2_ORYSJ (SCAR-like protein 2 OS=Oryza sativa subsp. japonica GN=Os01g0208600 PE=2 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 1.1e-07 Identity = 27/56 (48.21%), Postives = 37/56 (66.07%), Query Frame = 1
BLAST of Csa3G321320 vs. Swiss-Prot
Match: SCAR3_ARATH (Protein SCAR3 OS=Arabidopsis thaliana GN=SCAR3 PE=1 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 9.1e-07 Identity = 25/54 (46.30%), Postives = 36/54 (66.67%), Query Frame = 1
BLAST of Csa3G321320 vs. TrEMBL
Match: A0A0A0LCM5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G321320 PE=4 SV=1) HSP 1 Score: 200.3 bits (508), Expect = 1.1e-48 Identity = 101/101 (100.00%), Postives = 101/101 (100.00%), Query Frame = 1
BLAST of Csa3G321320 vs. TrEMBL
Match: A0A0A0L2T0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G315020 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 3.0e-17 Identity = 47/55 (85.45%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of Csa3G321320 vs. TrEMBL
Match: A0A067F7J6_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g000435mg PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 40/55 (72.73%), Postives = 47/55 (85.45%), Query Frame = 1
BLAST of Csa3G321320 vs. TrEMBL
Match: A0A067F7D7_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g000435mg PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 40/55 (72.73%), Postives = 47/55 (85.45%), Query Frame = 1
BLAST of Csa3G321320 vs. TrEMBL
Match: V4SUS8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10010899mg PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 40/55 (72.73%), Postives = 47/55 (85.45%), Query Frame = 1
BLAST of Csa3G321320 vs. TAIR10
Match: AT2G38440.1 (AT2G38440.1 SCAR homolog 2) HSP 1 Score: 71.2 bits (173), Expect = 4.0e-13 Identity = 33/55 (60.00%), Postives = 40/55 (72.73%), Query Frame = 1
BLAST of Csa3G321320 vs. TAIR10
Match: AT5G01730.1 (AT5G01730.1 SCAR family protein 4) HSP 1 Score: 60.1 bits (144), Expect = 9.3e-10 Identity = 27/58 (46.55%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of Csa3G321320 vs. TAIR10
Match: AT1G29170.1 (AT1G29170.1 SCAR family protein) HSP 1 Score: 54.3 bits (129), Expect = 5.1e-08 Identity = 25/54 (46.30%), Postives = 36/54 (66.67%), Query Frame = 1
BLAST of Csa3G321320 vs. TAIR10
Match: AT2G34150.2 (AT2G34150.2 SCAR family protein) HSP 1 Score: 53.9 bits (128), Expect = 6.7e-08 Identity = 24/54 (44.44%), Postives = 38/54 (70.37%), Query Frame = 1
BLAST of Csa3G321320 vs. NCBI nr
Match: gi|700202688|gb|KGN57821.1| (hypothetical protein Csa_3G321320 [Cucumis sativus]) HSP 1 Score: 200.3 bits (508), Expect = 1.6e-48 Identity = 101/101 (100.00%), Postives = 101/101 (100.00%), Query Frame = 1
BLAST of Csa3G321320 vs. NCBI nr
Match: gi|659128525|ref|XP_008464247.1| (PREDICTED: protein SCAR2 isoform X1 [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 1.9e-17 Identity = 48/55 (87.27%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of Csa3G321320 vs. NCBI nr
Match: gi|659128527|ref|XP_008464248.1| (PREDICTED: protein SCAR2 isoform X2 [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 1.9e-17 Identity = 48/55 (87.27%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of Csa3G321320 vs. NCBI nr
Match: gi|449461789|ref|XP_004148624.1| (PREDICTED: protein SCAR2 isoform X2 [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 4.3e-17 Identity = 47/55 (85.45%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of Csa3G321320 vs. NCBI nr
Match: gi|778693922|ref|XP_011653714.1| (PREDICTED: protein SCAR2 isoform X1 [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 4.3e-17 Identity = 47/55 (85.45%), Postives = 50/55 (90.91%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|