Csa1G569530 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGAGAGAATTGGGAAAGTCTTCAACTACCAATAGCCAATGTTGAGAGAATAATGAAGAAGATAGTTCCAGAAAAGGGAAAGATTTCAAAAGAAGCCAAGAAGAGAATGCAAGAATGTGCGAATGAGTTCATTAACTTTGTCACAAGTGAAGCAGCACAAAGATGTCAGAATGAGAATAGAAGAACTCTCAATGGTGATGATATCTATTGGGCATTTGATTCTCTTGGCTTAGATAATTATGCTGAGGCTTCTTCCAAGTACCTGCTTAAGTTCAGAGAAGCTGAGAGAATCAAAGCTTCTGATAAAGCTATTATTACTTTCCAAGATCAACATGCAGGAGAAGAGGATCAATGA ATGGGAGAGAATTGGGAAAGTCTTCAACTACCAATAGCCAATGTTGAGAGAATAATGAAGAAGATAGTTCCAGAAAAGGGAAAGATTTCAAAAGAAGCCAAGAAGAGAATGCAAGAATGTGCGAATGAGTTCATTAACTTTGTCACAAGTGAAGCAGCACAAAGATGTCAGAATGAGAATAGAAGAACTCTCAATGGTGATGATATCTATTGGGCATTTGATTCTCTTGGCTTAGATAATTATGCTGAGGCTTCTTCCAAGTACCTGCTTAAGTTCAGAGAAGCTGAGAGAATCAAAGCTTCTGATAAAGCTATTATTACTTTCCAAGATCAACATGCAGGAGAAGAGGATCAATGA ATGGGAGAGAATTGGGAAAGTCTTCAACTACCAATAGCCAATGTTGAGAGAATAATGAAGAAGATAGTTCCAGAAAAGGGAAAGATTTCAAAAGAAGCCAAGAAGAGAATGCAAGAATGTGCGAATGAGTTCATTAACTTTGTCACAAGTGAAGCAGCACAAAGATGTCAGAATGAGAATAGAAGAACTCTCAATGGTGATGATATCTATTGGGCATTTGATTCTCTTGGCTTAGATAATTATGCTGAGGCTTCTTCCAAGTACCTGCTTAAGTTCAGAGAAGCTGAGAGAATCAAAGCTTCTGATAAAGCTATTATTACTTTCCAAGATCAACATGCAGGAGAAGAGGATCAATGA MGENWESLQLPIANVERIMKKIVPEKGKISKEAKKRMQECANEFINFVTSEAAQRCQNENRRTLNGDDIYWAFDSLGLDNYAEASSKYLLKFREAERIKASDKAIITFQDQHAGEEDQ*
BLAST of Csa1G569530 vs. Swiss-Prot
Match: NFYB4_ARATH (Nuclear transcription factor Y subunit B-4 OS=Arabidopsis thaliana GN=NFYB4 PE=1 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 2.9e-28 Identity = 58/92 (63.04%), Postives = 73/92 (79.35%), Query Frame = 1
BLAST of Csa1G569530 vs. Swiss-Prot
Match: NFYB_MAIZE (Nuclear transcription factor Y subunit B OS=Zea mays GN=NFY2 PE=2 SV=1) HSP 1 Score: 113.2 bits (282), Expect = 1.9e-24 Identity = 53/101 (52.48%), Postives = 71/101 (70.30%), Query Frame = 1
BLAST of Csa1G569530 vs. Swiss-Prot
Match: NFYB3_ORYSJ (Nuclear transcription factor Y subunit B-3 OS=Oryza sativa subsp. japonica GN=NFYB3 PE=1 SV=2) HSP 1 Score: 112.8 bits (281), Expect = 2.5e-24 Identity = 49/87 (56.32%), Postives = 65/87 (74.71%), Query Frame = 1
BLAST of Csa1G569530 vs. Swiss-Prot
Match: NFYB2_ARATH (Nuclear transcription factor Y subunit B-2 OS=Arabidopsis thaliana GN=NFYB2 PE=2 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 3.3e-24 Identity = 51/87 (58.62%), Postives = 63/87 (72.41%), Query Frame = 1
BLAST of Csa1G569530 vs. Swiss-Prot
Match: NFYB7_ARATH (Nuclear transcription factor Y subunit B-7 OS=Arabidopsis thaliana GN=NFYB7 PE=2 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 4.3e-24 Identity = 51/92 (55.43%), Postives = 66/92 (71.74%), Query Frame = 1
BLAST of Csa1G569530 vs. TrEMBL
Match: A0A0A0LZ17_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G569530 PE=4 SV=1) HSP 1 Score: 239.6 bits (610), Expect = 2.0e-60 Identity = 118/118 (100.00%), Postives = 118/118 (100.00%), Query Frame = 1
BLAST of Csa1G569530 vs. TrEMBL
Match: A0A0A0LW12_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G569510 PE=4 SV=1) HSP 1 Score: 176.4 bits (446), Expect = 2.1e-41 Identity = 85/98 (86.73%), Postives = 92/98 (93.88%), Query Frame = 1
BLAST of Csa1G569530 vs. TrEMBL
Match: M5WPU4_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa021948mg PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.5e-28 Identity = 62/95 (65.26%), Postives = 80/95 (84.21%), Query Frame = 1
BLAST of Csa1G569530 vs. TrEMBL
Match: M1CB00_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400024745 PE=4 SV=1) HSP 1 Score: 131.7 bits (330), Expect = 5.8e-28 Identity = 62/109 (56.88%), Postives = 80/109 (73.39%), Query Frame = 1
BLAST of Csa1G569530 vs. TrEMBL
Match: A0A061F331_THECC (Nuclear transcription factor Y subunit B-4 OS=Theobroma cacao GN=TCM_026629 PE=4 SV=1) HSP 1 Score: 131.0 bits (328), Expect = 9.9e-28 Identity = 63/102 (61.76%), Postives = 77/102 (75.49%), Query Frame = 1
BLAST of Csa1G569530 vs. TAIR10
Match: AT1G09030.1 (AT1G09030.1 nuclear factor Y, subunit B4) HSP 1 Score: 125.9 bits (315), Expect = 1.6e-29 Identity = 58/92 (63.04%), Postives = 73/92 (79.35%), Query Frame = 1
BLAST of Csa1G569530 vs. TAIR10
Match: AT5G47640.1 (AT5G47640.1 nuclear factor Y, subunit B2) HSP 1 Score: 112.5 bits (280), Expect = 1.8e-25 Identity = 51/87 (58.62%), Postives = 63/87 (72.41%), Query Frame = 1
BLAST of Csa1G569530 vs. TAIR10
Match: AT2G13570.1 (AT2G13570.1 nuclear factor Y, subunit B7) HSP 1 Score: 112.1 bits (279), Expect = 2.4e-25 Identity = 51/92 (55.43%), Postives = 66/92 (71.74%), Query Frame = 1
BLAST of Csa1G569530 vs. TAIR10
Match: AT4G14540.1 (AT4G14540.1 nuclear factor Y, subunit B3) HSP 1 Score: 111.3 bits (277), Expect = 4.1e-25 Identity = 50/92 (54.35%), Postives = 65/92 (70.65%), Query Frame = 1
BLAST of Csa1G569530 vs. TAIR10
Match: AT3G53340.1 (AT3G53340.1 nuclear factor Y, subunit B10) HSP 1 Score: 110.2 bits (274), Expect = 9.2e-25 Identity = 48/87 (55.17%), Postives = 66/87 (75.86%), Query Frame = 1
BLAST of Csa1G569530 vs. NCBI nr
Match: gi|449435998|ref|XP_004135781.1| (PREDICTED: nuclear transcription factor Y subunit B-4-like [Cucumis sativus]) HSP 1 Score: 239.6 bits (610), Expect = 2.8e-60 Identity = 118/118 (100.00%), Postives = 118/118 (100.00%), Query Frame = 1
BLAST of Csa1G569530 vs. NCBI nr
Match: gi|659100539|ref|XP_008451143.1| (PREDICTED: beta-galactosidase 15-like [Cucumis melo]) HSP 1 Score: 201.8 bits (512), Expect = 6.6e-49 Identity = 102/117 (87.18%), Postives = 106/117 (90.60%), Query Frame = 1
BLAST of Csa1G569530 vs. NCBI nr
Match: gi|449435996|ref|XP_004135780.1| (PREDICTED: nuclear transcription factor Y subunit B-4-like [Cucumis sativus]) HSP 1 Score: 176.4 bits (446), Expect = 3.0e-41 Identity = 85/98 (86.73%), Postives = 92/98 (93.88%), Query Frame = 1
BLAST of Csa1G569530 vs. NCBI nr
Match: gi|659100537|ref|XP_008451142.1| (PREDICTED: nuclear transcription factor Y subunit B-4 [Cucumis melo]) HSP 1 Score: 156.8 bits (395), Expect = 2.4e-35 Identity = 77/97 (79.38%), Postives = 84/97 (86.60%), Query Frame = 1
BLAST of Csa1G569530 vs. NCBI nr
Match: gi|645222118|ref|XP_008246442.1| (PREDICTED: nuclear transcription factor Y subunit B-4 [Prunus mume]) HSP 1 Score: 133.7 bits (335), Expect = 2.2e-28 Identity = 62/95 (65.26%), Postives = 80/95 (84.21%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|