Csa1G530160 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGACACTTTTTGGCTGTAAAAATGAAAGAATGGATGCATTATTGAGTCAGCTTTTTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGGGCAGTGGTTGGTATTTGGAGTTCAATTGCTTGGTTGGTTGGTATGACCATACTCATATCTATTTTATCACAATACATTGTTGCAACAATTGAGGTAACATAA ATGACACTTTTTGGCTGTAAAAATGAAAGAATGGATGCATTATTGAGTCAGCTTTTTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGGGCAGTGGTTGGTATTTGGAGTTCAATTGCTTGGTTGGTTGGTATGACCATACTCATATCTATTTTATCACAATACATTGTTGCAACAATTGAGGTAACATAA ATGACACTTTTTGGCTGTAAAAATGAAAGAATGGATGCATTATTGAGTCAGCTTTTTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAGGGCAGTGGTTGGTATTTGGAGTTCAATTGCTTGGTTGGTTGGTATGACCATACTCATATCTATTTTATCACAATACATTGTTGCAACAATTGAGGTAACATAA MTLFGCKNERMDALLSQLFEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEERAVVGIWSSIAWLVGMTILISILSQYIVATIEVT*
BLAST of Csa1G530160 vs. Swiss-Prot
Match: RTL1_MOUSE (Retrotransposon-like protein 1 OS=Mus musculus GN=Rtl1 PE=2 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.1e-20 Identity = 56/87 (64.37%), Postives = 63/87 (72.41%), Query Frame = 1
HSP 2 Score: 74.3 bits (181), Expect = 8.8e-13 Identity = 39/61 (63.93%), Postives = 45/61 (73.77%), Query Frame = 1
BLAST of Csa1G530160 vs. Swiss-Prot
Match: VG73_ALHV1 (Uncharacterized gene 73 protein OS=Alcelaphine herpesvirus 1 (strain C500) GN=73 PE=4 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 3.7e-19 Identity = 44/61 (72.13%), Postives = 55/61 (90.16%), Query Frame = 1
BLAST of Csa1G530160 vs. Swiss-Prot
Match: LAS1L_MOUSE (Ribosomal biogenesis protein LAS1L OS=Mus musculus GN=Las1l PE=1 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.3e-16 Identity = 42/67 (62.69%), Postives = 52/67 (77.61%), Query Frame = 1
HSP 2 Score: 77.8 bits (190), Expect = 8.0e-14 Identity = 37/56 (66.07%), Postives = 46/56 (82.14%), Query Frame = 1
HSP 3 Score: 74.3 bits (181), Expect = 8.8e-13 Identity = 46/98 (46.94%), Postives = 58/98 (59.18%), Query Frame = 1
BLAST of Csa1G530160 vs. Swiss-Prot
Match: RYR1_RABIT (Ryanodine receptor 1 OS=Oryctolagus cuniculus GN=RYR1 PE=1 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.5e-15 Identity = 42/77 (54.55%), Postives = 58/77 (75.32%), Query Frame = 1
BLAST of Csa1G530160 vs. Swiss-Prot
Match: FKBP5_DICDI (FK506-binding protein 5 OS=Dictyostelium discoideum GN=fkbp5 PE=1 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.2e-15 Identity = 37/56 (66.07%), Postives = 51/56 (91.07%), Query Frame = 1
HSP 2 Score: 70.9 bits (172), Expect = 9.7e-12 Identity = 39/68 (57.35%), Postives = 48/68 (70.59%), Query Frame = 1
HSP 3 Score: 49.7 bits (117), Expect = 2.3e-05 Identity = 27/56 (48.21%), Postives = 34/56 (60.71%), Query Frame = 1
HSP 4 Score: 49.7 bits (117), Expect = 2.3e-05 Identity = 33/93 (35.48%), Postives = 49/93 (52.69%), Query Frame = 1
HSP 5 Score: 44.3 bits (103), Expect = 9.8e-04 Identity = 36/106 (33.96%), Postives = 48/106 (45.28%), Query Frame = 1
BLAST of Csa1G530160 vs. TrEMBL
Match: A0A0A0LXL5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G530160 PE=4 SV=1) HSP 1 Score: 205.7 bits (522), Expect = 2.8e-50 Identity = 105/105 (100.00%), Postives = 105/105 (100.00%), Query Frame = 1
BLAST of Csa1G530160 vs. TrEMBL
Match: U1FVY1_ENDPU (Uncharacterized protein OS=Endocarpon pusillum (strain Z07020 / HMAS-L-300199) GN=EPUS_06689 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.2e-21 Identity = 54/59 (91.53%), Postives = 55/59 (93.22%), Query Frame = 1
BLAST of Csa1G530160 vs. TrEMBL
Match: A0A0A0KB23_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G452320 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 8.0e-21 Identity = 54/62 (87.10%), Postives = 57/62 (91.94%), Query Frame = 1
BLAST of Csa1G530160 vs. TrEMBL
Match: M6VB36_LEPIR (Uncharacterized protein OS=Leptospira interrogans str. HAI1536 GN=LEP1GSC172_3748 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 1.0e-20 Identity = 54/57 (94.74%), Postives = 55/57 (96.49%), Query Frame = 1
BLAST of Csa1G530160 vs. TrEMBL
Match: A0A0A0L7Y0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G130870 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 1.0e-20 Identity = 55/65 (84.62%), Postives = 57/65 (87.69%), Query Frame = 1
BLAST of Csa1G530160 vs. TAIR10
Match: AT4G02810.1 (AT4G02810.1 Protein of unknown function (DUF3049)) HSP 1 Score: 80.5 bits (197), Expect = 6.9e-16 Identity = 40/61 (65.57%), Postives = 47/61 (77.05%), Query Frame = 1
HSP 2 Score: 80.5 bits (197), Expect = 6.9e-16 Identity = 37/52 (71.15%), Postives = 44/52 (84.62%), Query Frame = 1
BLAST of Csa1G530160 vs. TAIR10
Match: AT1G47300.1 (AT1G47300.1 F-box family protein) HSP 1 Score: 76.3 bits (186), Expect = 1.3e-14 Identity = 36/53 (67.92%), Postives = 40/53 (75.47%), Query Frame = 1
HSP 2 Score: 72.8 bits (177), Expect = 1.4e-13 Identity = 40/75 (53.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of Csa1G530160 vs. TAIR10
Match: AT5G40340.1 (AT5G40340.1 Tudor/PWWP/MBT superfamily protein) HSP 1 Score: 70.1 bits (170), Expect = 9.4e-13 Identity = 34/45 (75.56%), Postives = 38/45 (84.44%), Query Frame = 1
HSP 2 Score: 68.2 bits (165), Expect = 3.6e-12 Identity = 36/51 (70.59%), Postives = 40/51 (78.43%), Query Frame = 1
HSP 3 Score: 34.7 bits (78), Expect = 4.4e-02 Identity = 14/49 (28.57%), Postives = 29/49 (59.18%), Query Frame = 1
BLAST of Csa1G530160 vs. TAIR10
Match: AT3G14670.1 (AT3G14670.1 unknown protein) HSP 1 Score: 69.7 bits (169), Expect = 1.2e-12 Identity = 31/60 (51.67%), Postives = 45/60 (75.00%), Query Frame = 1
HSP 2 Score: 66.6 bits (161), Expect = 1.0e-11 Identity = 33/54 (61.11%), Postives = 39/54 (72.22%), Query Frame = 1
HSP 3 Score: 46.6 bits (109), Expect = 1.1e-05 Identity = 26/68 (38.24%), Postives = 37/68 (54.41%), Query Frame = 1
BLAST of Csa1G530160 vs. TAIR10
Match: AT4G12740.1 (AT4G12740.1 HhH-GPD base excision DNA repair family protein) HSP 1 Score: 68.9 bits (167), Expect = 2.1e-12 Identity = 35/57 (61.40%), Postives = 38/57 (66.67%), Query Frame = 1
HSP 2 Score: 64.3 bits (155), Expect = 5.1e-11 Identity = 36/66 (54.55%), Postives = 40/66 (60.61%), Query Frame = 1
BLAST of Csa1G530160 vs. NCBI nr
Match: gi|700210708|gb|KGN65804.1| (hypothetical protein Csa_1G530160 [Cucumis sativus]) HSP 1 Score: 205.7 bits (522), Expect = 4.0e-50 Identity = 105/105 (100.00%), Postives = 105/105 (100.00%), Query Frame = 1
BLAST of Csa1G530160 vs. NCBI nr
Match: gi|629663243|ref|XP_007805350.1| (hypothetical protein EPUS_06689 [Endocarpon pusillum Z07020]) HSP 1 Score: 110.5 bits (275), Expect = 1.8e-21 Identity = 54/59 (91.53%), Postives = 55/59 (93.22%), Query Frame = 1
BLAST of Csa1G530160 vs. NCBI nr
Match: gi|700198504|gb|KGN53662.1| (hypothetical protein Csa_4G097690 [Cucumis sativus]) HSP 1 Score: 109.4 bits (272), Expect = 3.9e-21 Identity = 59/95 (62.11%), Postives = 69/95 (72.63%), Query Frame = 1
BLAST of Csa1G530160 vs. NCBI nr
Match: gi|676272520|gb|KFO27327.1| (hypothetical protein H920_11289 [Fukomys damarensis]) HSP 1 Score: 109.0 bits (271), Expect = 5.2e-21 Identity = 53/57 (92.98%), Postives = 56/57 (98.25%), Query Frame = 1
BLAST of Csa1G530160 vs. NCBI nr
Match: gi|676272520|gb|KFO27327.1| (hypothetical protein H920_11289 [Fukomys damarensis]) HSP 1 Score: 104.8 bits (260), Expect = 9.7e-20 Identity = 52/52 (100.00%), Postives = 52/52 (100.00%), Query Frame = 1
HSP 2 Score: 108.2 bits (269), Expect = 8.8e-21 Identity = 54/59 (91.53%), Postives = 56/59 (94.92%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |