Csa1G186650 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACGGTGTTTTACCAACTGAAGAGTACATGGAGGAGGAGCTGTTGTTCTTCACACATGAGCGTAAGGTCTGAGTTTTTATATATAGAGATATTCATGCCTAGATTATTTCATCCTCAACTTTGATATCTACAATTTTTGTAGAAAAACTACGAAAATCACCTCGAAGTCCTAGGAGTTGAAAAAAGTTCAAGATGAATTGGAAAGTTACAGGAATTTCTATGACTTGGGTGAAAGAGAAGTGCTAATGGAAGAGATTCAAGATTTAAGAAGTCGGCAGCAATACTACATTGATTCACCCTCTACATCCTCGTGA ATGGACGGTGTTTTACCAACTGAAGAGTACATGGAGGAGGAGCTGTTGTTCTTCACACATGAGCGTAAGGAGTTGAAAAAAGTTCAAGATGAATTGGAAAGTTACAGGAATTTCTATGACTTGGGTGAAAGAGAAGTGCTAATGGAAGAGATTCAAGATTTAAGAAGTCGGCAGCAATACTACATTGATTCACCCTCTACATCCTCGTGA ATGGACGGTGTTTTACCAACTGAAGAGTACATGGAGGAGGAGCTGTTGTTCTTCACACATGAGCGTAAGGAGTTGAAAAAAGTTCAAGATGAATTGGAAAGTTACAGGAATTTCTATGACTTGGGTGAAAGAGAAGTGCTAATGGAAGAGATTCAAGATTTAAGAAGTCGGCAGCAATACTACATTGATTCACCCTCTACATCCTCGTGA MDGVLPTEEYMEEELLFFTHERKELKKVQDELESYRNFYDLGEREVLMEEIQDLRSRQQYYIDSPSTSS*
BLAST of Csa1G186650 vs. Swiss-Prot
Match: KN12B_ARATH (Kinesin-like protein KIN12B OS=Arabidopsis thaliana GN=KIN12B PE=1 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.3e-12 Identity = 40/87 (45.98%), Postives = 53/87 (60.92%), Query Frame = 1
BLAST of Csa1G186650 vs. Swiss-Prot
Match: KN12A_ARATH (Kinesin-like protein KIN12A OS=Arabidopsis thaliana GN=KIN12A PE=1 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.2e-11 Identity = 39/87 (44.83%), Postives = 52/87 (59.77%), Query Frame = 1
BLAST of Csa1G186650 vs. TrEMBL
Match: A0A0A0LT44_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G186650 PE=4 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 5.6e-31 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of Csa1G186650 vs. TrEMBL
Match: A0A0A0L899_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G172990 PE=3 SV=1) HSP 1 Score: 112.5 bits (280), Expect = 2.1e-22 Identity = 60/85 (70.59%), Postives = 63/85 (74.12%), Query Frame = 1
BLAST of Csa1G186650 vs. TrEMBL
Match: A0A151U8K1_CAJCA (Kinesin-like protein KIF15 OS=Cajanus cajan GN=KK1_019847 PE=3 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.5e-19 Identity = 54/86 (62.79%), Postives = 61/86 (70.93%), Query Frame = 1
BLAST of Csa1G186650 vs. TrEMBL
Match: A0A0B2QWN3_GLYSO (Kinesin-like protein KIF15 OS=Glycine soja GN=glysoja_025215 PE=3 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.4e-19 Identity = 53/86 (61.63%), Postives = 61/86 (70.93%), Query Frame = 1
BLAST of Csa1G186650 vs. TrEMBL
Match: I1MYC2_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_18G003800 PE=3 SV=2) HSP 1 Score: 100.5 bits (249), Expect = 8.4e-19 Identity = 53/86 (61.63%), Postives = 61/86 (70.93%), Query Frame = 1
BLAST of Csa1G186650 vs. TAIR10
Match: AT3G23670.1 (AT3G23670.1 phragmoplast-associated kinesin-related protein, putative) HSP 1 Score: 73.2 bits (178), Expect = 7.3e-14 Identity = 40/87 (45.98%), Postives = 53/87 (60.92%), Query Frame = 1
BLAST of Csa1G186650 vs. TAIR10
Match: AT4G14150.1 (AT4G14150.1 phragmoplast-associated kinesin-related protein 1) HSP 1 Score: 68.2 bits (165), Expect = 2.3e-12 Identity = 39/87 (44.83%), Postives = 52/87 (59.77%), Query Frame = 1
BLAST of Csa1G186650 vs. NCBI nr
Match: gi|700209964|gb|KGN65060.1| (hypothetical protein Csa_1G186650 [Cucumis sativus]) HSP 1 Score: 141.0 bits (354), Expect = 8.1e-31 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of Csa1G186650 vs. NCBI nr
Match: gi|659077156|ref|XP_008439062.1| (PREDICTED: kinesin-like protein KIN12B [Cucumis melo]) HSP 1 Score: 112.5 bits (280), Expect = 3.1e-22 Identity = 60/85 (70.59%), Postives = 63/85 (74.12%), Query Frame = 1
BLAST of Csa1G186650 vs. NCBI nr
Match: gi|778679262|ref|XP_011651111.1| (PREDICTED: kinesin-like protein KIN12B [Cucumis sativus]) HSP 1 Score: 112.5 bits (280), Expect = 3.1e-22 Identity = 60/85 (70.59%), Postives = 63/85 (74.12%), Query Frame = 1
BLAST of Csa1G186650 vs. NCBI nr
Match: gi|1012364473|gb|KYP75655.1| (Kinesin-like protein KIF15 [Cajanus cajan]) HSP 1 Score: 100.9 bits (250), Expect = 9.3e-19 Identity = 54/86 (62.79%), Postives = 61/86 (70.93%), Query Frame = 1
BLAST of Csa1G186650 vs. NCBI nr
Match: gi|658004713|ref|XP_008337488.1| (PREDICTED: kinesin-like protein KIN12B [Malus domestica]) HSP 1 Score: 100.9 bits (250), Expect = 9.3e-19 Identity = 53/86 (61.63%), Postives = 62/86 (72.09%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (Chinese Long)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|