Csa1G025930 (gene) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAAAATTGAAAGTGTCTACAAAATCAGATACGTAGACACTATCGCCATCCCAATTCGACTCCGTAGGAAGTGGTTTGTGTTTTATTCTACAATCTCTGTGATTTTGTAAAATTAAAGGAAAAAGAAGAAGAAGGTGAAGAAGAAACTAATTTAAAGCAAATTCTCTATTTAACTAGCTACCCTGGCTTTTCATTCAAGGGTCACTTTGAACTTCGAGCTACTTTATCCTCCTCATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCAAATCCGACTAAATTATAA ATGAAAATTGAAAGTGTCTACAAAATCAGATACGTAGACACTATCGCCATCCCAATTCGACTCCGTAGGAAGTGGGTCACTTTGAACTTCGAGCTACTTTATCCTCCTCATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCAAATCCGACTAAATTATAA ATGAAAATTGAAAGTGTCTACAAAATCAGATACGTAGACACTATCGCCATCCCAATTCGACTCCGTAGGAAGTGGGTCACTTTGAACTTCGAGCTACTTTATCCTCCTCATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCAAATCCGACTAAATTATAA MKIESVYKIRYVDTIAIPIRLRRKWVTLNFELLYPPHSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSNPTKL*
BLAST of Csa1G025930 vs. Swiss-Prot
Match: TPRXL_HUMAN (Putative protein TPRXL OS=Homo sapiens GN=TPRXL PE=5 SV=2) HSP 1 Score: 60.1 bits (144), Expect = 1.3e-08 Identity = 35/41 (85.37%), Postives = 35/41 (85.37%), Query Frame = 1
HSP 2 Score: 57.8 bits (138), Expect = 6.4e-08 Identity = 34/39 (87.18%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 3 Score: 57.0 bits (136), Expect = 1.1e-07 Identity = 33/38 (86.84%), Postives = 34/38 (89.47%), Query Frame = 1
HSP 4 Score: 56.6 bits (135), Expect = 1.4e-07 Identity = 33/39 (84.62%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 5 Score: 56.2 bits (134), Expect = 1.8e-07 Identity = 33/38 (86.84%), Postives = 33/38 (86.84%), Query Frame = 1
HSP 6 Score: 55.8 bits (133), Expect = 2.4e-07 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 7 Score: 55.5 bits (132), Expect = 3.2e-07 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 8 Score: 55.1 bits (131), Expect = 4.1e-07 Identity = 32/42 (76.19%), Postives = 33/42 (78.57%), Query Frame = 1
HSP 9 Score: 55.1 bits (131), Expect = 4.1e-07 Identity = 32/41 (78.05%), Postives = 33/41 (80.49%), Query Frame = 1
HSP 10 Score: 54.3 bits (129), Expect = 7.0e-07 Identity = 32/39 (82.05%), Postives = 32/39 (82.05%), Query Frame = 1
HSP 11 Score: 51.6 bits (122), Expect = 4.6e-06 Identity = 34/49 (69.39%), Postives = 35/49 (71.43%), Query Frame = 1
HSP 12 Score: 50.1 bits (118), Expect = 1.3e-05 Identity = 29/41 (70.73%), Postives = 31/41 (75.61%), Query Frame = 1
HSP 13 Score: 49.7 bits (117), Expect = 1.7e-05 Identity = 29/37 (78.38%), Postives = 30/37 (81.08%), Query Frame = 1
HSP 14 Score: 49.7 bits (117), Expect = 1.7e-05 Identity = 29/39 (74.36%), Postives = 31/39 (79.49%), Query Frame = 1
HSP 15 Score: 48.9 bits (115), Expect = 3.0e-05 Identity = 31/45 (68.89%), Postives = 34/45 (75.56%), Query Frame = 1
HSP 16 Score: 48.9 bits (115), Expect = 3.0e-05 Identity = 31/43 (72.09%), Postives = 33/43 (76.74%), Query Frame = 1
HSP 17 Score: 46.2 bits (108), Expect = 1.9e-04 Identity = 31/46 (67.39%), Postives = 32/46 (69.57%), Query Frame = 1
HSP 18 Score: 45.4 bits (106), Expect = 3.3e-04 Identity = 28/38 (73.68%), Postives = 28/38 (73.68%), Query Frame = 1
HSP 19 Score: 44.3 bits (103), Expect = 7.3e-04 Identity = 28/39 (71.79%), Postives = 28/39 (71.79%), Query Frame = 1
BLAST of Csa1G025930 vs. Swiss-Prot
Match: VIT1_CHICK (Vitellogenin-1 OS=Gallus gallus GN=VTG1 PE=1 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 8.3e-08 Identity = 34/40 (85.00%), Postives = 34/40 (85.00%), Query Frame = 1
HSP 2 Score: 53.9 bits (128), Expect = 9.2e-07 Identity = 32/40 (80.00%), Postives = 31/40 (77.50%), Query Frame = 1
HSP 3 Score: 51.2 bits (121), Expect = 5.9e-06 Identity = 30/37 (81.08%), Postives = 29/37 (78.38%), Query Frame = 1
HSP 4 Score: 47.4 bits (111), Expect = 8.6e-05 Identity = 32/56 (57.14%), Postives = 34/56 (60.71%), Query Frame = 1
HSP 5 Score: 47.0 bits (110), Expect = 1.1e-04 Identity = 27/37 (72.97%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 6 Score: 43.5 bits (101), Expect = 1.2e-03 Identity = 25/36 (69.44%), Postives = 26/36 (72.22%), Query Frame = 1
HSP 7 Score: 40.0 bits (92), Expect = 1.4e-02 Identity = 22/35 (62.86%), Postives = 25/35 (71.43%), Query Frame = 1
HSP 8 Score: 36.6 bits (83), Expect = 1.5e-01 Identity = 21/30 (70.00%), Postives = 21/30 (70.00%), Query Frame = 1
HSP 9 Score: 36.6 bits (83), Expect = 1.5e-01 Identity = 22/44 (50.00%), Postives = 28/44 (63.64%), Query Frame = 1
HSP 10 Score: 35.4 bits (80), Expect = 3.4e-01 Identity = 19/39 (48.72%), Postives = 22/39 (56.41%), Query Frame = 1
HSP 11 Score: 33.5 bits (75), Expect = 1.3e+00 Identity = 18/39 (46.15%), Postives = 25/39 (64.10%), Query Frame = 1
HSP 12 Score: 32.7 bits (73), Expect = 2.2e+00 Identity = 17/36 (47.22%), Postives = 25/36 (69.44%), Query Frame = 1
BLAST of Csa1G025930 vs. Swiss-Prot
Match: SRP40_YEAST (Suppressor protein SRP40 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SRP40 PE=1 SV=2) HSP 1 Score: 57.4 bits (137), Expect = 8.3e-08 Identity = 34/37 (91.89%), Postives = 33/37 (89.19%), Query Frame = 1
HSP 2 Score: 55.8 bits (133), Expect = 2.4e-07 Identity = 33/37 (89.19%), Postives = 32/37 (86.49%), Query Frame = 1
HSP 3 Score: 55.5 bits (132), Expect = 3.2e-07 Identity = 34/49 (69.39%), Postives = 38/49 (77.55%), Query Frame = 1
HSP 4 Score: 54.3 bits (129), Expect = 7.0e-07 Identity = 32/37 (86.49%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 5 Score: 52.8 bits (125), Expect = 2.0e-06 Identity = 31/37 (83.78%), Postives = 30/37 (81.08%), Query Frame = 1
HSP 6 Score: 52.4 bits (124), Expect = 2.7e-06 Identity = 31/36 (86.11%), Postives = 29/36 (80.56%), Query Frame = 1
HSP 7 Score: 51.6 bits (122), Expect = 4.6e-06 Identity = 30/40 (75.00%), Postives = 31/40 (77.50%), Query Frame = 1
HSP 8 Score: 51.2 bits (121), Expect = 5.9e-06 Identity = 30/37 (81.08%), Postives = 29/37 (78.38%), Query Frame = 1
HSP 9 Score: 50.8 bits (120), Expect = 7.8e-06 Identity = 29/39 (74.36%), Postives = 28/39 (71.79%), Query Frame = 1
HSP 10 Score: 49.3 bits (116), Expect = 2.3e-05 Identity = 29/36 (80.56%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 11 Score: 48.5 bits (114), Expect = 3.9e-05 Identity = 28/40 (70.00%), Postives = 27/40 (67.50%), Query Frame = 1
HSP 12 Score: 48.1 bits (113), Expect = 5.0e-05 Identity = 28/37 (75.68%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 13 Score: 46.6 bits (109), Expect = 1.5e-04 Identity = 27/37 (72.97%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 14 Score: 46.6 bits (109), Expect = 1.5e-04 Identity = 27/37 (72.97%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 15 Score: 46.6 bits (109), Expect = 1.5e-04 Identity = 27/37 (72.97%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 16 Score: 46.6 bits (109), Expect = 1.5e-04 Identity = 27/37 (72.97%), Postives = 26/37 (70.27%), Query Frame = 1
HSP 17 Score: 45.1 bits (105), Expect = 4.3e-04 Identity = 26/37 (70.27%), Postives = 25/37 (67.57%), Query Frame = 1
HSP 18 Score: 45.1 bits (105), Expect = 4.3e-04 Identity = 26/37 (70.27%), Postives = 25/37 (67.57%), Query Frame = 1
HSP 19 Score: 45.1 bits (105), Expect = 4.3e-04 Identity = 26/37 (70.27%), Postives = 25/37 (67.57%), Query Frame = 1
HSP 20 Score: 42.4 bits (98), Expect = 2.8e-03 Identity = 24/37 (64.86%), Postives = 24/37 (64.86%), Query Frame = 1
HSP 21 Score: 42.4 bits (98), Expect = 2.8e-03 Identity = 24/37 (64.86%), Postives = 24/37 (64.86%), Query Frame = 1
HSP 22 Score: 42.4 bits (98), Expect = 2.8e-03 Identity = 29/48 (60.42%), Postives = 27/48 (56.25%), Query Frame = 1
HSP 23 Score: 35.4 bits (80), Expect = 3.4e-01 Identity = 30/65 (46.15%), Postives = 28/65 (43.08%), Query Frame = 1
HSP 24 Score: 35.0 bits (79), Expect = 4.4e-01 Identity = 19/36 (52.78%), Postives = 21/36 (58.33%), Query Frame = 1
BLAST of Csa1G025930 vs. TrEMBL
Match: A0A0A0LQ34_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025930 PE=4 SV=1) HSP 1 Score: 145.6 bits (366), Expect = 2.6e-32 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = 1
BLAST of Csa1G025930 vs. TrEMBL
Match: K0KGK1_WICCF (Putative mucin-1 OS=Wickerhamomyces ciferrii (strain F-60-10 / ATCC 14091 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031) GN=BN7_844 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 4.4e-08 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of Csa1G025930 vs. TrEMBL
Match: K0KGK1_WICCF (Putative mucin-1 OS=Wickerhamomyces ciferrii (strain F-60-10 / ATCC 14091 / CBS 111 / JCM 3599 / NBRC 0793 / NRRL Y-1031) GN=BN7_844 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.2e-05 Identity = 34/36 (94.44%), Postives = 35/36 (97.22%), Query Frame = 1
HSP 2 Score: 56.6 bits (135), Expect = 1.6e-05 Identity = 33/41 (80.49%), Postives = 38/41 (92.68%), Query Frame = 1
HSP 3 Score: 52.8 bits (125), Expect = 2.3e-04 Identity = 31/41 (75.61%), Postives = 36/41 (87.80%), Query Frame = 1
HSP 4 Score: 49.3 bits (116), Expect = 2.5e-03 Identity = 28/37 (75.68%), Postives = 29/37 (78.38%), Query Frame = 1
HSP 5 Score: 45.4 bits (106), Expect = 3.6e-02 Identity = 27/41 (65.85%), Postives = 32/41 (78.05%), Query Frame = 1
HSP 6 Score: 45.1 bits (105), Expect = 4.7e-02 Identity = 30/44 (68.18%), Postives = 34/44 (77.27%), Query Frame = 1
HSP 7 Score: 44.3 bits (103), Expect = 8.1e-02 Identity = 30/53 (56.60%), Postives = 35/53 (66.04%), Query Frame = 1
HSP 8 Score: 38.9 bits (89), Expect = 3.4e+00 Identity = 29/56 (51.79%), Postives = 32/56 (57.14%), Query Frame = 1
HSP 9 Score: 28.9 bits (63), Expect = 3.5e+03 Identity = 23/52 (44.23%), Postives = 31/52 (59.62%), Query Frame = 1
HSP 10 Score: 63.9 bits (154), Expect = 9.9e-08 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
BLAST of Csa1G025930 vs. TrEMBL
Match: A0A072V4W9_MEDTR (Late embryogenesis abundant (LEA)-like protein OS=Medicago truncatula GN=MTR_2g030845 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.1e-06 Identity = 31/42 (73.81%), Postives = 40/42 (95.24%), Query Frame = 1
HSP 2 Score: 57.0 bits (136), Expect = 1.2e-05 Identity = 31/41 (75.61%), Postives = 34/41 (82.93%), Query Frame = 1
HSP 3 Score: 57.0 bits (136), Expect = 1.2e-05 Identity = 39/59 (66.10%), Postives = 40/59 (67.80%), Query Frame = 1
HSP 4 Score: 55.1 bits (131), Expect = 4.6e-05 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = 1
HSP 5 Score: 54.7 bits (130), Expect = 6.0e-05 Identity = 30/39 (76.92%), Postives = 36/39 (92.31%), Query Frame = 1
HSP 6 Score: 50.8 bits (120), Expect = 8.6e-04 Identity = 29/43 (67.44%), Postives = 33/43 (76.74%), Query Frame = 1
HSP 7 Score: 47.8 bits (112), Expect = 7.3e-03 Identity = 28/37 (75.68%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 8 Score: 45.8 bits (107), Expect = 2.8e-02 Identity = 33/55 (60.00%), Postives = 37/55 (67.27%), Query Frame = 1
HSP 9 Score: 39.7 bits (91), Expect = 2.0e+00 Identity = 24/41 (58.54%), Postives = 28/41 (68.29%), Query Frame = 1
HSP 10 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 37/38 (97.37%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of Csa1G025930 vs. TrEMBL
Match: A0A146TJ93_FUNHE (Uncharacterized protein (Fragment) OS=Fundulus heteroclitus PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 8.4e-07 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 3 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 4 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 5 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 6 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 7 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 8 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 9 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
HSP 10 Score: 55.8 bits (133), Expect = 2.7e-05 Identity = 33/38 (86.84%), Postives = 34/38 (89.47%), Query Frame = 1
HSP 11 Score: 53.1 bits (126), Expect = 1.7e-04 Identity = 32/37 (86.49%), Postives = 34/37 (91.89%), Query Frame = 1
HSP 12 Score: 43.9 bits (102), Expect = 1.1e-01 Identity = 27/36 (75.00%), Postives = 29/36 (80.56%), Query Frame = 1
HSP 13 Score: 39.3 bits (90), Expect = 2.6e+00 Identity = 25/42 (59.52%), Postives = 26/42 (61.90%), Query Frame = 1
HSP 14 Score: 32.7 bits (73), Expect = 2.4e+02 Identity = 21/40 (52.50%), Postives = 26/40 (65.00%), Query Frame = 1
HSP 15 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
BLAST of Csa1G025930 vs. NCBI nr
Match: gi|523577585|gb|EPR64220.1| (zinc finger, C3HC4 type (RING finger) domain-containing protein [Toxoplasma gondii GT1]) HSP 1 Score: 65.5 bits (158), Expect = 4.9e-08 Identity = 38/40 (95.00%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of Csa1G025930 vs. NCBI nr
Match: gi|523577585|gb|EPR64220.1| (zinc finger, C3HC4 type (RING finger) domain-containing protein [Toxoplasma gondii GT1]) HSP 1 Score: 59.3 bits (142), Expect = 3.5e-06 Identity = 35/42 (83.33%), Postives = 37/42 (88.10%), Query Frame = 1
HSP 2 Score: 54.7 bits (130), Expect = 8.6e-05 Identity = 34/44 (77.27%), Postives = 35/44 (79.55%), Query Frame = 1
HSP 3 Score: 53.9 bits (128), Expect = 1.5e-04 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 4 Score: 53.9 bits (128), Expect = 1.5e-04 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 5 Score: 53.9 bits (128), Expect = 1.5e-04 Identity = 32/39 (82.05%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 6 Score: 53.5 bits (127), Expect = 1.9e-04 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 1
HSP 7 Score: 52.8 bits (125), Expect = 3.3e-04 Identity = 31/38 (81.58%), Postives = 34/38 (89.47%), Query Frame = 1
HSP 8 Score: 50.1 bits (118), Expect = 2.1e-03 Identity = 28/37 (75.68%), Postives = 34/37 (91.89%), Query Frame = 1
HSP 9 Score: 48.1 bits (113), Expect = 8.0e-03 Identity = 28/38 (73.68%), Postives = 33/38 (86.84%), Query Frame = 1
HSP 10 Score: 47.0 bits (110), Expect = 1.8e-02 Identity = 26/39 (66.67%), Postives = 33/39 (84.62%), Query Frame = 1
HSP 11 Score: 39.3 bits (90), Expect = 3.7e+00 Identity = 24/40 (60.00%), Postives = 30/40 (75.00%), Query Frame = 1
HSP 12 Score: 34.3 bits (77), Expect = 1.2e+02 Identity = 24/46 (52.17%), Postives = 29/46 (63.04%), Query Frame = 1
HSP 13 Score: 33.1 bits (74), Expect = 2.7e+02 Identity = 19/65 (29.23%), Postives = 39/65 (60.00%), Query Frame = 1
HSP 14 Score: 65.1 bits (157), Expect = 6.4e-08 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of Csa1G025930 vs. NCBI nr
Match: gi|754417931|ref|XP_011276861.1| (putative mucin-1 [Wickerhamomyces ciferrii]) HSP 1 Score: 57.8 bits (138), Expect = 1.0e-05 Identity = 34/40 (85.00%), Postives = 38/40 (95.00%), Query Frame = 1
HSP 2 Score: 56.6 bits (135), Expect = 2.3e-05 Identity = 33/41 (80.49%), Postives = 38/41 (92.68%), Query Frame = 1
HSP 3 Score: 52.8 bits (125), Expect = 3.3e-04 Identity = 31/41 (75.61%), Postives = 36/41 (87.80%), Query Frame = 1
HSP 4 Score: 49.3 bits (116), Expect = 3.6e-03 Identity = 28/37 (75.68%), Postives = 29/37 (78.38%), Query Frame = 1
HSP 5 Score: 47.8 bits (112), Expect = 1.1e-02 Identity = 29/36 (80.56%), Postives = 30/36 (83.33%), Query Frame = 1
HSP 6 Score: 47.0 bits (110), Expect = 1.8e-02 Identity = 30/41 (73.17%), Postives = 30/41 (73.17%), Query Frame = 1
HSP 7 Score: 45.4 bits (106), Expect = 5.2e-02 Identity = 27/41 (65.85%), Postives = 32/41 (78.05%), Query Frame = 1
HSP 8 Score: 45.1 bits (105), Expect = 6.8e-02 Identity = 30/44 (68.18%), Postives = 34/44 (77.27%), Query Frame = 1
HSP 9 Score: 44.3 bits (103), Expect = 1.2e-01 Identity = 30/53 (56.60%), Postives = 35/53 (66.04%), Query Frame = 1
HSP 10 Score: 42.7 bits (99), Expect = 3.4e-01 Identity = 27/36 (75.00%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 11 Score: 41.6 bits (96), Expect = 7.5e-01 Identity = 30/47 (63.83%), Postives = 30/47 (63.83%), Query Frame = 1
HSP 12 Score: 41.2 bits (95), Expect = 9.8e-01 Identity = 26/36 (72.22%), Postives = 27/36 (75.00%), Query Frame = 1
HSP 13 Score: 39.7 bits (91), Expect = 2.9e+00 Identity = 28/57 (49.12%), Postives = 34/57 (59.65%), Query Frame = 1
HSP 14 Score: 38.9 bits (89), Expect = 4.9e+00 Identity = 29/56 (51.79%), Postives = 32/56 (57.14%), Query Frame = 1
HSP 15 Score: 38.5 bits (88), Expect = 6.4e+00 Identity = 27/39 (69.23%), Postives = 28/39 (71.79%), Query Frame = 1
HSP 16 Score: 37.4 bits (85), Expect = 1.4e+01 Identity = 25/37 (67.57%), Postives = 27/37 (72.97%), Query Frame = 1
HSP 17 Score: 63.9 bits (154), Expect = 1.4e-07 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
BLAST of Csa1G025930 vs. NCBI nr
Match: gi|922389100|ref|XP_013463024.1| (late embryogenesis abundant (LEA)-like protein [Medicago truncatula]) HSP 1 Score: 58.5 bits (140), Expect = 6.0e-06 Identity = 31/42 (73.81%), Postives = 40/42 (95.24%), Query Frame = 1
HSP 2 Score: 57.0 bits (136), Expect = 1.7e-05 Identity = 31/41 (75.61%), Postives = 34/41 (82.93%), Query Frame = 1
HSP 3 Score: 57.0 bits (136), Expect = 1.7e-05 Identity = 39/59 (66.10%), Postives = 40/59 (67.80%), Query Frame = 1
HSP 4 Score: 55.1 bits (131), Expect = 6.6e-05 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = 1
HSP 5 Score: 54.7 bits (130), Expect = 8.6e-05 Identity = 30/39 (76.92%), Postives = 36/39 (92.31%), Query Frame = 1
HSP 6 Score: 50.8 bits (120), Expect = 1.2e-03 Identity = 29/43 (67.44%), Postives = 33/43 (76.74%), Query Frame = 1
HSP 7 Score: 50.1 bits (118), Expect = 2.1e-03 Identity = 36/56 (64.29%), Postives = 38/56 (67.86%), Query Frame = 1
HSP 8 Score: 47.8 bits (112), Expect = 1.1e-02 Identity = 28/37 (75.68%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 9 Score: 45.8 bits (107), Expect = 4.0e-02 Identity = 33/55 (60.00%), Postives = 37/55 (67.27%), Query Frame = 1
HSP 10 Score: 39.7 bits (91), Expect = 2.9e+00 Identity = 24/41 (58.54%), Postives = 28/41 (68.29%), Query Frame = 1
HSP 11 Score: 63.5 bits (153), Expect = 1.9e-07 Identity = 36/41 (87.80%), Postives = 39/41 (95.12%), Query Frame = 1
BLAST of Csa1G025930 vs. NCBI nr
Match: gi|922389096|ref|XP_013463022.1| (late embryogenesis abundant (LEA)-like protein [Medicago truncatula]) HSP 1 Score: 58.5 bits (140), Expect = 6.0e-06 Identity = 31/42 (73.81%), Postives = 40/42 (95.24%), Query Frame = 1
HSP 2 Score: 57.0 bits (136), Expect = 1.7e-05 Identity = 31/41 (75.61%), Postives = 34/41 (82.93%), Query Frame = 1
HSP 3 Score: 57.0 bits (136), Expect = 1.7e-05 Identity = 39/59 (66.10%), Postives = 40/59 (67.80%), Query Frame = 1
HSP 4 Score: 55.1 bits (131), Expect = 6.6e-05 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = 1
HSP 5 Score: 54.7 bits (130), Expect = 8.6e-05 Identity = 30/39 (76.92%), Postives = 36/39 (92.31%), Query Frame = 1
HSP 6 Score: 50.8 bits (120), Expect = 1.2e-03 Identity = 29/43 (67.44%), Postives = 33/43 (76.74%), Query Frame = 1
HSP 7 Score: 50.1 bits (118), Expect = 2.1e-03 Identity = 36/56 (64.29%), Postives = 38/56 (67.86%), Query Frame = 1
HSP 8 Score: 47.8 bits (112), Expect = 1.1e-02 Identity = 28/37 (75.68%), Postives = 31/37 (83.78%), Query Frame = 1
HSP 9 Score: 45.8 bits (107), Expect = 4.0e-02 Identity = 33/55 (60.00%), Postives = 37/55 (67.27%), Query Frame = 1
HSP 10 Score: 39.7 bits (91), Expect = 2.9e+00 Identity = 24/41 (58.54%), Postives = 28/41 (68.29%), Query Frame = 1
HSP 11 Score: 62.8 bits (151), Expect = 3.2e-07 Identity = 37/38 (97.37%), Postives = 37/38 (97.37%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|