Cp4.1LG11g03960 (gene) Cucurbita pepo (Zucchini)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGAACATGTGGGCAATAACCCACAACGAGAGGGTTTGGTTAGAGCCAGAGAAATTCGAGCCAAATCGGTTCATGGAAGAGGAAATTAGTGTAATGGGGAGTGATTTGAGGTTGGCTCCATTTGGGGCAGGGCGAAGGGTTTGTCCGGGAAAGGCTATGGGTTTAGCCACCGTGCAGCTCTGGTTAGCTCAGCTGCTTCGAGCTTACAAATGGGTGGCGTGTTCTGAAGAAGCCGCCATTAATGGCGGCATCGATTTGTCAGAGTGCCTTAAACTCTCTCTGGAAATGGAAGCTCCTCTGGTTTGTAGAGCCATTGGGAGGAGGGTGGGTTTGGCAGAGGAATGA ATGGTGAACATGTGGGCAATAACCCACAACGAGAGGGTTTGGTTAGAGCCAGAGAAATTCGAGCCAAATCGGTTCATGGAAGAGGAAATTAGTGTAATGGGGAGTGATTTGAGGTTGGCTCCATTTGGGGCAGGGCGAAGGGTTTGTCCGGGAAAGGCTATGGGTTTAGCCACCGTGCAGCTCTGGTTAGCTCAGCTGCTTCGAGCTTACAAATGGGTGGCGTGTTCTGAAGAAGCCGCCATTAATGGCGGCATCGATTTGTCAGAGTGCCTTAAACTCTCTCTGGAAATGGAAGCTCCTCTGGTTTGTAGAGCCATTGGGAGGAGGGTGGGTTTGGCAGAGGAATGA ATGGTGAACATGTGGGCAATAACCCACAACGAGAGGGTTTGGTTAGAGCCAGAGAAATTCGAGCCAAATCGGTTCATGGAAGAGGAAATTAGTGTAATGGGGAGTGATTTGAGGTTGGCTCCATTTGGGGCAGGGCGAAGGGTTTGTCCGGGAAAGGCTATGGGTTTAGCCACCGTGCAGCTCTGGTTAGCTCAGCTGCTTCGAGCTTACAAATGGGTGGCGTGTTCTGAAGAAGCCGCCATTAATGGCGGCATCGATTTGTCAGAGTGCCTTAAACTCTCTCTGGAAATGGAAGCTCCTCTGGTTTGTAGAGCCATTGGGAGGAGGGTGGGTTTGGCAGAGGAATGA MVNMWAITHNERVWLEPEKFEPNRFMEEEISVMGSDLRLAPFGAGRRVCPGKAMGLATVQLWLAQLLRAYKWVACSEEAAINGGIDLSECLKLSLEMEAPLVCRAIGRRVGLAEE
BLAST of Cp4.1LG11g03960 vs. Swiss-Prot
Match: C78A5_ARATH (Cytochrome P450 78A5 OS=Arabidopsis thaliana GN=CYP78A5 PE=2 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 3.1e-35 Identity = 67/113 (59.29%), Postives = 89/113 (78.76%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. Swiss-Prot
Match: C78A4_PINRA (Cytochrome P450 78A4 OS=Pinus radiata GN=CYP78A4 PE=2 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 3.6e-28 Identity = 62/112 (55.36%), Postives = 78/112 (69.64%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. Swiss-Prot
Match: C78A1_MAIZE (Cytochrome P450 78A1 OS=Zea mays GN=CYP78A1 PE=2 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 1.8e-27 Identity = 63/112 (56.25%), Postives = 76/112 (67.86%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. Swiss-Prot
Match: C78AB_ORYSJ (Cytochrome P450 78A11 OS=Oryza sativa subsp. japonica GN=CYP78A11 PE=1 SV=2) HSP 1 Score: 122.1 bits (305), Expect = 4.0e-27 Identity = 62/113 (54.87%), Postives = 74/113 (65.49%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. Swiss-Prot
Match: C78A7_ARATH (Cytochrome P450 78A7 OS=Arabidopsis thaliana GN=CYP78A7 PE=2 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.6e-26 Identity = 59/102 (57.84%), Postives = 72/102 (70.59%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TrEMBL
Match: A0A0A0KDP5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G366560 PE=3 SV=1) HSP 1 Score: 185.7 bits (470), Expect = 3.3e-44 Identity = 86/108 (79.63%), Postives = 98/108 (90.74%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TrEMBL
Match: A0A118K0U8_CYNCS (Cytochrome P450 OS=Cynara cardunculus var. scolymus GN=Ccrd_019822 PE=3 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.9e-40 Identity = 76/108 (70.37%), Postives = 96/108 (88.89%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TrEMBL
Match: A0A0B4VRI9_SALMI (Cytochrome P450 CYP78A113 OS=Salvia miltiorrhiza PE=2 SV=1) HSP 1 Score: 169.1 bits (427), Expect = 3.2e-39 Identity = 77/108 (71.30%), Postives = 91/108 (84.26%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TrEMBL
Match: V4THW5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10031237mg PE=3 SV=1) HSP 1 Score: 168.7 bits (426), Expect = 4.1e-39 Identity = 81/108 (75.00%), Postives = 97/108 (89.81%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TrEMBL
Match: F6GTD9_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g05110 PE=3 SV=1) HSP 1 Score: 167.9 bits (424), Expect = 7.1e-39 Identity = 76/108 (70.37%), Postives = 95/108 (87.96%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TAIR10
Match: AT1G13710.1 (AT1G13710.1 cytochrome P450, family 78, subfamily A, polypeptide 5) HSP 1 Score: 149.1 bits (375), Expect = 1.7e-36 Identity = 67/113 (59.29%), Postives = 89/113 (78.76%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TAIR10
Match: AT1G74110.1 (AT1G74110.1 cytochrome P450, family 78, subfamily A, polypeptide 10) HSP 1 Score: 147.1 bits (370), Expect = 6.5e-36 Identity = 73/112 (65.18%), Postives = 88/112 (78.57%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TAIR10
Match: AT5G09970.1 (AT5G09970.1 cytochrome P450, family 78, subfamily A, polypeptide 7) HSP 1 Score: 119.4 bits (298), Expect = 1.5e-27 Identity = 59/102 (57.84%), Postives = 72/102 (70.59%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TAIR10
Match: AT3G61880.2 (AT3G61880.2 cytochrome p450 78a9) HSP 1 Score: 119.4 bits (298), Expect = 1.5e-27 Identity = 61/113 (53.98%), Postives = 75/113 (66.37%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. TAIR10
Match: AT2G46660.1 (AT2G46660.1 cytochrome P450, family 78, subfamily A, polypeptide 6) HSP 1 Score: 116.3 bits (290), Expect = 1.2e-26 Identity = 56/113 (49.56%), Postives = 75/113 (66.37%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. NCBI nr
Match: gi|449453027|ref|XP_004144260.1| (PREDICTED: cytochrome P450 78A5 [Cucumis sativus]) HSP 1 Score: 185.7 bits (470), Expect = 4.7e-44 Identity = 86/108 (79.63%), Postives = 98/108 (90.74%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. NCBI nr
Match: gi|659089313|ref|XP_008445440.1| (PREDICTED: cytochrome P450 78A5 [Cucumis melo]) HSP 1 Score: 185.3 bits (469), Expect = 6.1e-44 Identity = 85/108 (78.70%), Postives = 98/108 (90.74%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. NCBI nr
Match: gi|1009154445|ref|XP_015895174.1| (PREDICTED: cytochrome P450 78A5 [Ziziphus jujuba]) HSP 1 Score: 172.9 bits (437), Expect = 3.2e-40 Identity = 81/109 (74.31%), Postives = 95/109 (87.16%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. NCBI nr
Match: gi|976916376|gb|KVI01890.1| (cytochrome P450 [Cynara cardunculus var. scolymus]) HSP 1 Score: 172.6 bits (436), Expect = 4.1e-40 Identity = 76/108 (70.37%), Postives = 96/108 (88.89%), Query Frame = 1
BLAST of Cp4.1LG11g03960 vs. NCBI nr
Match: gi|698492419|ref|XP_009792560.1| (PREDICTED: cytochrome P450 78A5-like [Nicotiana sylvestris]) HSP 1 Score: 169.5 bits (428), Expect = 3.5e-39 Identity = 77/108 (71.30%), Postives = 93/108 (86.11%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita pepo
Date Performed: 2017-12-02
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|