CmoCh19G007240 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGGTTTCCGTCTGCCTAGAATTGTTAGTACTAAGCAAAGTCTTCAGCGATCTTCATCAACAGGGAATGGAGCATCTCCAAAGGCTGTCGATGTTCCAAAGGGATACTTCACGGTTTATGTTGGTGAAGCACAAAAGAAGCGTTTTGTCATTCCACTATCTTACTTGAACCAGCCTTCGTTTCAAGATTTGTTGAGTCAAGCAGAGGAAGAATTTGGATACAATCATCCAATGGGTGGCATCACAATTCCTTGCAGTGAAGACGATTTCCTCGATCTCACTCGGAGTTTGAATGACTCATGA ATGGGTTTCCGTCTGCCTAGAATTGTTAGTACTAAGCAAAGTCTTCAGCGATCTTCATCAACAGGGAATGGAGCATCTCCAAAGGCTGTCGATGTTCCAAAGGGATACTTCACGGTTTATGTTGGTGAAGCACAAAAGAAGCGTTTTGTCATTCCACTATCTTACTTGAACCAGCCTTCGTTTCAAGATTTGTTGAGTCAAGCAGAGGAAGAATTTGGATACAATCATCCAATGGGTGGCATCACAATTCCTTGCAGTGAAGACGATTTCCTCGATCTCACTCGGAGTTTGAATGACTCATGA ATGGGTTTCCGTCTGCCTAGAATTGTTAGTACTAAGCAAAGTCTTCAGCGATCTTCATCAACAGGGAATGGAGCATCTCCAAAGGCTGTCGATGTTCCAAAGGGATACTTCACGGTTTATGTTGGTGAAGCACAAAAGAAGCGTTTTGTCATTCCACTATCTTACTTGAACCAGCCTTCGTTTCAAGATTTGTTGAGTCAAGCAGAGGAAGAATTTGGATACAATCATCCAATGGGTGGCATCACAATTCCTTGCAGTGAAGACGATTTCCTCGATCTCACTCGGAGTTTGAATGACTCATGA
BLAST of CmoCh19G007240 vs. Swiss-Prot
Match: AX10A_SOYBN (Auxin-induced protein X10A OS=Glycine max PE=2 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 2.8e-29 Identity = 63/99 (63.64%), Postives = 78/99 (78.79%), Query Frame = 1
BLAST of CmoCh19G007240 vs. Swiss-Prot
Match: AX6B_SOYBN (Auxin-induced protein 6B OS=Glycine max PE=2 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 1.6e-27 Identity = 64/98 (65.31%), Postives = 75/98 (76.53%), Query Frame = 1
BLAST of CmoCh19G007240 vs. Swiss-Prot
Match: ARG7_VIGRR (Indole-3-acetic acid-induced protein ARG7 OS=Vigna radiata var. radiata GN=ARG7 PE=2 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.7e-26 Identity = 62/98 (63.27%), Postives = 72/98 (73.47%), Query Frame = 1
BLAST of CmoCh19G007240 vs. Swiss-Prot
Match: A10A5_SOYBN (Auxin-induced protein 10A5 OS=Glycine max PE=2 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.9e-26 Identity = 59/99 (59.60%), Postives = 76/99 (76.77%), Query Frame = 1
BLAST of CmoCh19G007240 vs. Swiss-Prot
Match: AX15A_SOYBN (Auxin-induced protein 15A OS=Glycine max PE=2 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 5.0e-26 Identity = 64/98 (65.31%), Postives = 70/98 (71.43%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TrEMBL
Match: A0A0A0K4J0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G008980 PE=4 SV=1) HSP 1 Score: 190.3 bits (482), Expect = 1.2e-45 Identity = 92/100 (92.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TrEMBL
Match: A0A0A0K5T8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G009020 PE=4 SV=1) HSP 1 Score: 190.3 bits (482), Expect = 1.2e-45 Identity = 91/100 (91.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TrEMBL
Match: A0A0A0K160_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G008990 PE=4 SV=1) HSP 1 Score: 187.6 bits (475), Expect = 7.5e-45 Identity = 90/100 (90.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TrEMBL
Match: A0A0A0K0H9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G009010 PE=4 SV=1) HSP 1 Score: 180.3 bits (456), Expect = 1.2e-42 Identity = 86/99 (86.87%), Postives = 92/99 (92.93%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TrEMBL
Match: A0A0A0K0H6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G008960 PE=4 SV=1) HSP 1 Score: 175.6 bits (444), Expect = 2.9e-41 Identity = 88/102 (86.27%), Postives = 92/102 (90.20%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TAIR10
Match: AT4G38840.1 (AT4G38840.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 125.6 bits (314), Expect = 1.8e-29 Identity = 57/99 (57.58%), Postives = 77/99 (77.78%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TAIR10
Match: AT5G18080.1 (AT5G18080.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 110.9 bits (276), Expect = 4.5e-25 Identity = 50/90 (55.56%), Postives = 69/90 (76.67%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TAIR10
Match: AT5G18010.1 (AT5G18010.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 109.4 bits (272), Expect = 1.3e-24 Identity = 50/90 (55.56%), Postives = 69/90 (76.67%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TAIR10
Match: AT5G18020.1 (AT5G18020.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 108.2 bits (269), Expect = 2.9e-24 Identity = 48/87 (55.17%), Postives = 68/87 (78.16%), Query Frame = 1
BLAST of CmoCh19G007240 vs. TAIR10
Match: AT5G18050.1 (AT5G18050.1 SAUR-like auxin-responsive protein family ) HSP 1 Score: 107.8 bits (268), Expect = 3.8e-24 Identity = 49/90 (54.44%), Postives = 69/90 (76.67%), Query Frame = 1
BLAST of CmoCh19G007240 vs. NCBI nr
Match: gi|778722823|ref|XP_011658575.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 190.3 bits (482), Expect = 1.7e-45 Identity = 92/100 (92.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. NCBI nr
Match: gi|778722830|ref|XP_004144905.2| (PREDICTED: auxin-induced protein X10A-like [Cucumis sativus]) HSP 1 Score: 190.3 bits (482), Expect = 1.7e-45 Identity = 91/100 (91.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. NCBI nr
Match: gi|778722820|ref|XP_011658574.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 187.6 bits (475), Expect = 1.1e-44 Identity = 90/100 (90.00%), Postives = 95/100 (95.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. NCBI nr
Match: gi|659094352|ref|XP_008448014.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 187.6 bits (475), Expect = 1.1e-44 Identity = 89/100 (89.00%), Postives = 94/100 (94.00%), Query Frame = 1
BLAST of CmoCh19G007240 vs. NCBI nr
Match: gi|659094354|ref|XP_008448015.1| (PREDICTED: LOW QUALITY PROTEIN: auxin-induced protein X10A-like [Cucumis melo]) HSP 1 Score: 185.3 bits (469), Expect = 5.3e-44 Identity = 90/100 (90.00%), Postives = 93/100 (93.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |