CmoCh19G006850 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTTCAATGTCTGCTCATGGGTCAGCTGGTTCATGGACTGCAAAGCAAAACAAAGCCTTTGAGAAGGCTTTGGCTGTGTATGATCAAGACACACCTGAGCGATGGCTCAATGTTGCTAAGGCCATTGGTGGGAAAACCGAAGAGGAAGTGAAGAGGCACTACCAACTTCTTTTGAAGGATGTTAAGCAAATTGAGTCTGGTGAAGTTCCTTTCCCATATGGAAGGTCCAGATGA ATGGCTTCAATGTCTGCTCATGGGTCAGCTGGTTCATGGACTGCAAAGCAAAACAAAGCCTTTGAGAAGGCTTTGGCTGTGTATGATCAAGACACACCTGAGCGATGGCTCAATGTTGCTAAGGCCATTGGTGGGAAAACCGAAGAGGAAGTGAAGAGGCACTACCAACTTCTTTTGAAGGATGTTAAGCAAATTGAGTCTGGTGAAGTTCCTTTCCCATATGGAAGGTCCAGATGA ATGGCTTCAATGTCTGCTCATGGGTCAGCTGGTTCATGGACTGCAAAGCAAAACAAAGCCTTTGAGAAGGCTTTGGCTGTGTATGATCAAGACACACCTGAGCGATGGCTCAATGTTGCTAAGGCCATTGGTGGGAAAACCGAAGAGGAAGTGAAGAGGCACTACCAACTTCTTTTGAAGGATGTTAAGCAAATTGAGTCTGGTGAAGTTCCTTTCCCATATGGAAGGTCCAGATGA
BLAST of CmoCh19G006850 vs. Swiss-Prot
Match: RADL1_ARATH (Protein RADIALIS-like 1 OS=Arabidopsis thaliana GN=RL1 PE=2 SV=1) HSP 1 Score: 111.7 bits (278), Expect = 3.7e-24 Identity = 53/76 (69.74%), Postives = 64/76 (84.21%), Query Frame = 1
BLAST of CmoCh19G006850 vs. Swiss-Prot
Match: RADL2_ARATH (Protein RADIALIS-like 2 OS=Arabidopsis thaliana GN=RL2 PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.1e-23 Identity = 51/71 (71.83%), Postives = 62/71 (87.32%), Query Frame = 1
BLAST of CmoCh19G006850 vs. Swiss-Prot
Match: RAD_ANTMA (Transcription factor RADIALIS OS=Antirrhinum majus GN=RAD PE=1 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.6e-22 Identity = 46/73 (63.01%), Postives = 62/73 (84.93%), Query Frame = 1
BLAST of CmoCh19G006850 vs. Swiss-Prot
Match: RADL3_ARATH (Protein RADIALIS-like 3 OS=Arabidopsis thaliana GN=RL3 PE=2 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 2.9e-21 Identity = 50/77 (64.94%), Postives = 60/77 (77.92%), Query Frame = 1
BLAST of CmoCh19G006850 vs. Swiss-Prot
Match: RADL6_ARATH (Protein RADIALIS-like 6 OS=Arabidopsis thaliana GN=RL6 PE=2 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.6e-19 Identity = 47/73 (64.38%), Postives = 56/73 (76.71%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TrEMBL
Match: A0A0A0K344_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G169070 PE=4 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 5.9e-29 Identity = 66/78 (84.62%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TrEMBL
Match: A0A0A0K3K0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G168060 PE=4 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 5.0e-28 Identity = 63/77 (81.82%), Postives = 72/77 (93.51%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TrEMBL
Match: A0A0A0K348_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G170600 PE=4 SV=1) HSP 1 Score: 127.1 bits (318), Expect = 9.4e-27 Identity = 62/77 (80.52%), Postives = 69/77 (89.61%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TrEMBL
Match: W9QGR5_9ROSA (DnaJ homolog subfamily C member 2 OS=Morus notabilis GN=L484_018551 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 6.7e-25 Identity = 56/72 (77.78%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TrEMBL
Match: A0A0D2RSV3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G244000 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 6.7e-25 Identity = 59/76 (77.63%), Postives = 69/76 (90.79%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TAIR10
Match: AT4G39250.1 (AT4G39250.1 RAD-like 1) HSP 1 Score: 111.7 bits (278), Expect = 2.1e-25 Identity = 53/76 (69.74%), Postives = 64/76 (84.21%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TAIR10
Match: AT2G21650.1 (AT2G21650.1 Homeodomain-like superfamily protein) HSP 1 Score: 110.2 bits (274), Expect = 6.0e-25 Identity = 51/71 (71.83%), Postives = 62/71 (87.32%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TAIR10
Match: AT1G75250.1 (AT1G75250.1 RAD-like 6) HSP 1 Score: 96.3 bits (238), Expect = 9.0e-21 Identity = 47/73 (64.38%), Postives = 56/73 (76.71%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TAIR10
Match: AT1G19510.1 (AT1G19510.1 RAD-like 5) HSP 1 Score: 95.5 bits (236), Expect = 1.5e-20 Identity = 46/73 (63.01%), Postives = 58/73 (79.45%), Query Frame = 1
BLAST of CmoCh19G006850 vs. TAIR10
Match: AT2G18328.1 (AT2G18328.1 RAD-like 4) HSP 1 Score: 92.4 bits (228), Expect = 1.3e-19 Identity = 45/77 (58.44%), Postives = 58/77 (75.32%), Query Frame = 1
BLAST of CmoCh19G006850 vs. NCBI nr
Match: gi|659092351|ref|XP_008447025.1| (PREDICTED: protein RADIALIS-like 1 [Cucumis melo]) HSP 1 Score: 137.1 bits (344), Expect = 1.3e-29 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CmoCh19G006850 vs. NCBI nr
Match: gi|449466805|ref|XP_004151116.1| (PREDICTED: protein RADIALIS-like 1 [Cucumis sativus]) HSP 1 Score: 134.4 bits (337), Expect = 8.4e-29 Identity = 66/78 (84.62%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CmoCh19G006850 vs. NCBI nr
Match: gi|778725452|ref|XP_011658943.1| (PREDICTED: protein RADIALIS-like 1 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 7.1e-28 Identity = 63/77 (81.82%), Postives = 72/77 (93.51%), Query Frame = 1
BLAST of CmoCh19G006850 vs. NCBI nr
Match: gi|659092346|ref|XP_008447024.1| (PREDICTED: protein RADIALIS-like 1 [Cucumis melo]) HSP 1 Score: 129.4 bits (324), Expect = 2.7e-27 Identity = 63/77 (81.82%), Postives = 70/77 (90.91%), Query Frame = 1
BLAST of CmoCh19G006850 vs. NCBI nr
Match: gi|659092353|ref|XP_008447026.1| (PREDICTED: protein RADIALIS-like 1 [Cucumis melo]) HSP 1 Score: 127.5 bits (319), Expect = 1.0e-26 Identity = 61/77 (79.22%), Postives = 69/77 (89.61%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |