CmoCh19G005490 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGCTCCCCTCGTCTTTCGCTCAAGACTCGCCTCAAGATTATGTCGATGCCCACAACAAAGCTCGTGCTGAAGTTGGTGTTGGGCCGGTCCAGTGGGACGAAAAAGTAGCTAATTTTGCTCGACAATATGGCAACAAACATATCAATGACTGTGAAGCGGTGCACTCACACGGACCATTTGGTGAGAATATTTCATATGGTTTTCCTGACTTATCAGGCACTGCTGCAGTTCAGGAATGGGTTGATGAGAAGCAATTCTACGATCTTAGCACCAATACTTGTGCACCTTACAGCAGTTCAGGAATGGGTTGA ATGCTCCCCTCGTCTTTCGCTCAAGACTCGCCTCAAGATTATGTCGATGCCCACAACAAAGCTCGTGCTGAAGTTGGTGTTGGGCCGGTCCAGTGGGACGAAAAAGTAGCTAATTTTGCTCGACAATATGGCAACAAACATATCAATGACTGTGAAGCGGTGCACTCACACGGACCATTTGGTGAGAATATTTCATATGGTTTTCCTGACTTATCAGGCACTGCTGCAGTTCAGGAATGGGTTGATGAGAAGCAATTCTACGATCTTAGCACCAATACTTGTGCACCTTACAGCAGTTCAGGAATGGGTTGA ATGCTCCCCTCGTCTTTCGCTCAAGACTCGCCTCAAGATTATGTCGATGCCCACAACAAAGCTCGTGCTGAAGTTGGTGTTGGGCCGGTCCAGTGGGACGAAAAAGTAGCTAATTTTGCTCGACAATATGGCAACAAACATATCAATGACTGTGAAGCGGTGCACTCACACGGACCATTTGGTGAGAATATTTCATATGGTTTTCCTGACTTATCAGGCACTGCTGCAGTTCAGGAATGGGTTGATGAGAAGCAATTCTACGATCTTAGCACCAATACTTGTGCACCTTACAGCAGTTCAGGAATGGGTTGA
BLAST of CmoCh19G005490 vs. Swiss-Prot
Match: PRB1_TOBAC (Basic form of pathogenesis-related protein 1 OS=Nicotiana tabacum PE=3 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 9.4e-28 Identity = 50/94 (53.19%), Postives = 72/94 (76.60%), Query Frame = 1
BLAST of CmoCh19G005490 vs. Swiss-Prot
Match: PRB1_ARATH (Pathogenesis-related protein 1 OS=Arabidopsis thaliana GN=PRB1 PE=2 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.5e-25 Identity = 52/88 (59.09%), Postives = 66/88 (75.00%), Query Frame = 1
BLAST of CmoCh19G005490 vs. Swiss-Prot
Match: PR1_ARATH (Pathogenesis-related protein 1 OS=Arabidopsis thaliana GN=At2g14610 PE=1 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 4.4e-25 Identity = 52/94 (55.32%), Postives = 68/94 (72.34%), Query Frame = 1
BLAST of CmoCh19G005490 vs. Swiss-Prot
Match: PR1_SAMNI (Pathogenesis-related protein PR-1 type OS=Sambucus nigra PE=2 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 1.1e-23 Identity = 55/98 (56.12%), Postives = 67/98 (68.37%), Query Frame = 1
BLAST of CmoCh19G005490 vs. Swiss-Prot
Match: PR1A_SOLLC (Pathogenesis-related protein 1A1 OS=Solanum lycopersicum PE=2 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.4e-23 Identity = 46/93 (49.46%), Postives = 67/93 (72.04%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TrEMBL
Match: A0A0A0K6A4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G070253 PE=3 SV=1) HSP 1 Score: 152.1 bits (383), Expect = 3.6e-34 Identity = 68/95 (71.58%), Postives = 80/95 (84.21%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TrEMBL
Match: A0A0A0K2V9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G070255 PE=3 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 8.0e-34 Identity = 65/95 (68.42%), Postives = 82/95 (86.32%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TrEMBL
Match: H3K3Z1_CUCME (Pathogenesis-related protein 1-1a (Fragment) OS=Cucumis melo GN=PR1-1a PE=2 SV=1) HSP 1 Score: 146.7 bits (369), Expect = 1.5e-32 Identity = 64/88 (72.73%), Postives = 77/88 (87.50%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TrEMBL
Match: A0A0A0K7P0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G070254 PE=3 SV=1) HSP 1 Score: 144.4 bits (363), Expect = 7.5e-32 Identity = 62/94 (65.96%), Postives = 79/94 (84.04%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TrEMBL
Match: B2CZ52_CUCME (Pathogen-related protein 1 OS=Cucumis melo var. inodorus GN=Cuc m 3 PE=2 SV=1) HSP 1 Score: 135.6 bits (340), Expect = 3.5e-29 Identity = 60/94 (63.83%), Postives = 75/94 (79.79%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TAIR10
Match: AT2G14580.1 (AT2G14580.1 basic pathogenesis-related protein 1) HSP 1 Score: 116.7 bits (291), Expect = 8.5e-27 Identity = 52/88 (59.09%), Postives = 66/88 (75.00%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TAIR10
Match: AT4G33720.1 (AT4G33720.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 115.2 bits (287), Expect = 2.5e-26 Identity = 51/89 (57.30%), Postives = 65/89 (73.03%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TAIR10
Match: AT2G14610.1 (AT2G14610.1 pathogenesis-related gene 1) HSP 1 Score: 115.2 bits (287), Expect = 2.5e-26 Identity = 52/94 (55.32%), Postives = 68/94 (72.34%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TAIR10
Match: AT3G19690.1 (AT3G19690.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 108.6 bits (270), Expect = 2.3e-24 Identity = 45/90 (50.00%), Postives = 65/90 (72.22%), Query Frame = 1
BLAST of CmoCh19G005490 vs. TAIR10
Match: AT2G19990.1 (AT2G19990.1 pathogenesis-related protein-1-like) HSP 1 Score: 94.7 bits (234), Expect = 3.4e-20 Identity = 40/84 (47.62%), Postives = 57/84 (67.86%), Query Frame = 1
BLAST of CmoCh19G005490 vs. NCBI nr
Match: gi|659110129|ref|XP_008455064.1| (PREDICTED: pathogenesis-related protein PRB1-2-like [Cucumis melo]) HSP 1 Score: 157.9 bits (398), Expect = 9.4e-36 Identity = 70/95 (73.68%), Postives = 83/95 (87.37%), Query Frame = 1
BLAST of CmoCh19G005490 vs. NCBI nr
Match: gi|778724783|ref|XP_011658861.1| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 152.1 bits (383), Expect = 5.2e-34 Identity = 68/95 (71.58%), Postives = 80/95 (84.21%), Query Frame = 1
BLAST of CmoCh19G005490 vs. NCBI nr
Match: gi|778724786|ref|XP_004136929.2| (PREDICTED: pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 151.0 bits (380), Expect = 1.1e-33 Identity = 65/95 (68.42%), Postives = 82/95 (86.32%), Query Frame = 1
BLAST of CmoCh19G005490 vs. NCBI nr
Match: gi|659110133|ref|XP_008455066.1| (PREDICTED: basic form of pathogenesis-related protein 1 [Cucumis melo]) HSP 1 Score: 147.9 bits (372), Expect = 9.7e-33 Identity = 64/91 (70.33%), Postives = 79/91 (86.81%), Query Frame = 1
BLAST of CmoCh19G005490 vs. NCBI nr
Match: gi|377347202|dbj|BAL63012.1| (pathogenesis-related protein 1-1a, partial [Cucumis melo]) HSP 1 Score: 146.7 bits (369), Expect = 2.2e-32 Identity = 64/88 (72.73%), Postives = 77/88 (87.50%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |