CmoCh19G004660 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTCAGTTATTCTATCATTCTATGATATATAATCACGTGACATTTATAATTTCTTTATTGATCTTTTCATGTTTGTTTTAGACTACACCATACCAAAGGGATGGAACGTACTAATTTGGACCAGAGCTATTCATATGGACCCTCACTTATATTCAAATCCACGAGAGTTTGATCCTTCAAGATGGGAGGTAGGATTTATGATACCTACCAATTCATTAACATGTTTATCATAAAGATATTAATGTGGGTAGTGTTCATAAGCAGAATTATTCACCAAAGCCAGGAACATTCATCCCTTTTGGAATCGGAACTAGGTTTTGTCCTGGAAGTGAACTTACCAAGCTTGAGATTACAATTTTACTTCATCACTTTATCCTCAATTACAAGTAAATACCCATCCAAATCTATCTTTTTACTGTTTAATCAAAATAAAAATGCATAAGTGATGGAGTTGTTTTGTTTGTGTTATTGTAGAATGGAACGTGTCAATCCAAAATGCTGCATCACTCACTTGCCTGCCCCCAAGCTCGTAGACAATTGCCTTTGCACAATTACCAAGCTCCCATGA ATGGTCAACTACACCATACCAAAGGGATGGAACGTACTAATTTGGACCAGAGCTATTCATATGGACCCTCACTTATATTCAAATCCACGAGAGTTTGATCCTTCAAGATGGGAGAATTATTCACCAAAGCCAGGAACATTCATCCCTTTTGGAATCGGAACTAGGTTTTGTCCTGGAAGTGAACTTACCAAGCTTGAGATTACAATTTTACTTCATCACTTTATCCTCAATTACAAAATGGAACGTGTCAATCCAAAATGCTGCATCACTCACTTGCCTGCCCCCAAGCTCGTAGACAATTGCCTTTGCACAATTACCAAGCTCCCATGA ATGGTCAACTACACCATACCAAAGGGATGGAACGTACTAATTTGGACCAGAGCTATTCATATGGACCCTCACTTATATTCAAATCCACGAGAGTTTGATCCTTCAAGATGGGAGAATTATTCACCAAAGCCAGGAACATTCATCCCTTTTGGAATCGGAACTAGGTTTTGTCCTGGAAGTGAACTTACCAAGCTTGAGATTACAATTTTACTTCATCACTTTATCCTCAATTACAAAATGGAACGTGTCAATCCAAAATGCTGCATCACTCACTTGCCTGCCCCCAAGCTCGTAGACAATTGCCTTTGCACAATTACCAAGCTCCCATGA
BLAST of CmoCh19G004660 vs. Swiss-Prot
Match: KAO1_HORVU (Ent-kaurenoic acid oxidase 1 OS=Hordeum vulgare GN=KAO1 PE=1 SV=1) HSP 1 Score: 156.8 bits (395), Expect = 1.4e-37 Identity = 62/105 (59.05%), Postives = 82/105 (78.10%), Query Frame = 1
BLAST of CmoCh19G004660 vs. Swiss-Prot
Match: BAMO_GLYUR (Beta-amyrin 11-oxidase OS=Glycyrrhiza uralensis GN=CYP88D6 PE=1 SV=1) HSP 1 Score: 155.6 bits (392), Expect = 3.1e-37 Identity = 63/105 (60.00%), Postives = 81/105 (77.14%), Query Frame = 1
BLAST of CmoCh19G004660 vs. Swiss-Prot
Match: C88A1_MAIZE (Cytochrome P450 88A1 OS=Zea mays GN=CYP88A1 PE=2 SV=1) HSP 1 Score: 154.8 bits (390), Expect = 5.3e-37 Identity = 60/105 (57.14%), Postives = 82/105 (78.10%), Query Frame = 1
BLAST of CmoCh19G004660 vs. Swiss-Prot
Match: KAO2_ARATH (Ent-kaurenoic acid oxidase 2 OS=Arabidopsis thaliana GN=KAO2 PE=2 SV=2) HSP 1 Score: 151.4 bits (381), Expect = 5.8e-36 Identity = 61/107 (57.01%), Postives = 80/107 (74.77%), Query Frame = 1
BLAST of CmoCh19G004660 vs. Swiss-Prot
Match: KAO1_ARATH (Ent-kaurenoic acid oxidase 1 OS=Arabidopsis thaliana GN=KAO1 PE=2 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.9e-32 Identity = 56/107 (52.34%), Postives = 79/107 (73.83%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TrEMBL
Match: G7JZW7_MEDTR (Cytochrome P450 family ent-kaurenoic acid oxidase OS=Medicago truncatula GN=MTR_5g014250 PE=3 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.7e-40 Identity = 69/105 (65.71%), Postives = 86/105 (81.90%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TrEMBL
Match: A0A0S3T5A2_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.10G194500 PE=3 SV=1) HSP 1 Score: 171.0 bits (432), Expect = 7.9e-40 Identity = 70/105 (66.67%), Postives = 87/105 (82.86%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TrEMBL
Match: A0A0L9UPR8_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan06g020100 PE=3 SV=1) HSP 1 Score: 171.0 bits (432), Expect = 7.9e-40 Identity = 70/105 (66.67%), Postives = 87/105 (82.86%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TrEMBL
Match: A0A151TJ38_CAJCA (Ent-kaurenoic acid oxidase 1 OS=Cajanus cajan GN=KK1_013368 PE=3 SV=1) HSP 1 Score: 171.0 bits (432), Expect = 7.9e-40 Identity = 67/105 (63.81%), Postives = 88/105 (83.81%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TrEMBL
Match: V7CH44_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_002G005900g PE=3 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 1.3e-39 Identity = 67/105 (63.81%), Postives = 88/105 (83.81%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TAIR10
Match: AT2G32440.1 (AT2G32440.1 ent-kaurenoic acid hydroxylase 2) HSP 1 Score: 151.4 bits (381), Expect = 3.3e-37 Identity = 61/107 (57.01%), Postives = 80/107 (74.77%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TAIR10
Match: AT1G05160.1 (AT1G05160.1 cytochrome P450, family 88, subfamily A, polypeptide 3) HSP 1 Score: 138.7 bits (348), Expect = 2.2e-33 Identity = 56/107 (52.34%), Postives = 79/107 (73.83%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TAIR10
Match: AT3G19270.1 (AT3G19270.1 cytochrome P450, family 707, subfamily A, polypeptide 4) HSP 1 Score: 99.0 bits (245), Expect = 1.9e-21 Identity = 46/92 (50.00%), Postives = 59/92 (64.13%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TAIR10
Match: AT5G45340.1 (AT5G45340.1 cytochrome P450, family 707, subfamily A, polypeptide 3) HSP 1 Score: 97.1 bits (240), Expect = 7.3e-21 Identity = 45/90 (50.00%), Postives = 59/90 (65.56%), Query Frame = 1
BLAST of CmoCh19G004660 vs. TAIR10
Match: AT4G19230.2 (AT4G19230.2 cytochrome P450, family 707, subfamily A, polypeptide 1) HSP 1 Score: 95.5 bits (236), Expect = 2.1e-20 Identity = 42/76 (55.26%), Postives = 54/76 (71.05%), Query Frame = 1
BLAST of CmoCh19G004660 vs. NCBI nr
Match: gi|778688019|ref|XP_011652661.1| (PREDICTED: beta-amyrin 11-oxidase-like [Cucumis sativus]) HSP 1 Score: 199.9 bits (507), Expect = 2.3e-48 Identity = 87/106 (82.08%), Postives = 95/106 (89.62%), Query Frame = 1
BLAST of CmoCh19G004660 vs. NCBI nr
Match: gi|778688013|ref|XP_011652660.1| (PREDICTED: beta-amyrin 11-oxidase-like [Cucumis sativus]) HSP 1 Score: 179.1 bits (453), Expect = 4.2e-42 Identity = 77/105 (73.33%), Postives = 89/105 (84.76%), Query Frame = 1
BLAST of CmoCh19G004660 vs. NCBI nr
Match: gi|357482355|ref|XP_003611463.1| (cytochrome P450 family ent-kaurenoic acid oxidase [Medicago truncatula]) HSP 1 Score: 172.6 bits (436), Expect = 3.9e-40 Identity = 69/105 (65.71%), Postives = 86/105 (81.90%), Query Frame = 1
BLAST of CmoCh19G004660 vs. NCBI nr
Match: gi|502161557|ref|XP_004512204.1| (PREDICTED: beta-amyrin 11-oxidase-like [Cicer arietinum]) HSP 1 Score: 171.8 bits (434), Expect = 6.7e-40 Identity = 68/105 (64.76%), Postives = 85/105 (80.95%), Query Frame = 1
BLAST of CmoCh19G004660 vs. NCBI nr
Match: gi|951051858|ref|XP_014520542.1| (PREDICTED: beta-amyrin 11-oxidase-like [Vigna radiata var. radiata]) HSP 1 Score: 171.4 bits (433), Expect = 8.7e-40 Identity = 70/105 (66.67%), Postives = 87/105 (82.86%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |