CmoCh19G004630 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAACGATTAATGTTTGTATAATTATTGGATTTCTTTTAGGGGTTTACATGTTTGTGAGGAAACTCAATGAAATATGGTATTTGGTTAAGTTGGGAAGAAAGGCTTACAAATCTCTTCCTCCTGGTGATATGGGATGGCCTCTTCTTGGCTCCTCCTTCTCCTTTTACAAAGCATTTATAGTCGGAGGTGATCCCGACTCTTTCATTTATCACCTTCTTTCCAGGTATGTTTCTTCATCTCTCTTTTTCAGGTCATATGTATTGTTATTAGGTGCATATCATGA ATGGAAACGATTAATGTTTGTATAATTATTGGATTTCTTTTAGGGGTTTACATGTTTGTGAGGAAACTCAATGAAATATGGTATTTGGTTAAGTTGGGAAGAAAGGCTTACAAATCTCTTCCTCCTGGTGATATGGGATGGCCTCTTCTTGGCTCCTCCTTCTCCTTTTACAAAGCATTTATAGTCGGAGGTGATCCCGACTCTTTCATTTATCACCTTCTTTCCAGGTGCATATCATGA ATGGAAACGATTAATGTTTGTATAATTATTGGATTTCTTTTAGGGGTTTACATGTTTGTGAGGAAACTCAATGAAATATGGTATTTGGTTAAGTTGGGAAGAAAGGCTTACAAATCTCTTCCTCCTGGTGATATGGGATGGCCTCTTCTTGGCTCCTCCTTCTCCTTTTACAAAGCATTTATAGTCGGAGGTGATCCCGACTCTTTCATTTATCACCTTCTTTCCAGGTGCATATCATGA
BLAST of CmoCh19G004630 vs. Swiss-Prot
Match: BAMO_GLYUR (Beta-amyrin 11-oxidase OS=Glycyrrhiza uralensis GN=CYP88D6 PE=1 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.5e-09 Identity = 40/78 (51.28%), Postives = 47/78 (60.26%), Query Frame = 1
BLAST of CmoCh19G004630 vs. Swiss-Prot
Match: KAO2_ARATH (Ent-kaurenoic acid oxidase 2 OS=Arabidopsis thaliana GN=KAO2 PE=2 SV=2) HSP 1 Score: 53.9 bits (128), Expect = 9.2e-07 Identity = 32/70 (45.71%), Postives = 46/70 (65.71%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TrEMBL
Match: A0A0A0LI74_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G904060 PE=4 SV=1) HSP 1 Score: 129.0 bits (323), Expect = 2.5e-27 Identity = 57/73 (78.08%), Postives = 67/73 (91.78%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TrEMBL
Match: A0A0A0LF52_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G903530 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.9e-23 Identity = 53/76 (69.74%), Postives = 63/76 (82.89%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TrEMBL
Match: A0A097IYP6_CUCSA (Cytochrome P450 OS=Cucumis sativus GN=Csa3G903550 PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.0e-21 Identity = 52/76 (68.42%), Postives = 62/76 (81.58%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TrEMBL
Match: A0A0A0LHC2_CUCSA (Cytochrome P450 OS=Cucumis sativus GN=Csa3G9038540 PE=2 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.8e-17 Identity = 47/73 (64.38%), Postives = 58/73 (79.45%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TrEMBL
Match: A0A059CHU0_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_D02177 PE=3 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.1e-10 Identity = 42/80 (52.50%), Postives = 51/80 (63.75%), Query Frame = 1
BLAST of CmoCh19G004630 vs. TAIR10
Match: AT2G32440.1 (AT2G32440.1 ent-kaurenoic acid hydroxylase 2) HSP 1 Score: 53.9 bits (128), Expect = 5.2e-08 Identity = 32/70 (45.71%), Postives = 46/70 (65.71%), Query Frame = 1
BLAST of CmoCh19G004630 vs. NCBI nr
Match: gi|778688019|ref|XP_011652661.1| (PREDICTED: beta-amyrin 11-oxidase-like [Cucumis sativus]) HSP 1 Score: 132.9 bits (333), Expect = 2.5e-28 Identity = 59/76 (77.63%), Postives = 69/76 (90.79%), Query Frame = 1
BLAST of CmoCh19G004630 vs. NCBI nr
Match: gi|700205284|gb|KGN60417.1| (hypothetical protein Csa_3G904060 [Cucumis sativus]) HSP 1 Score: 129.0 bits (323), Expect = 3.6e-27 Identity = 57/73 (78.08%), Postives = 67/73 (91.78%), Query Frame = 1
BLAST of CmoCh19G004630 vs. NCBI nr
Match: gi|778688013|ref|XP_011652660.1| (PREDICTED: beta-amyrin 11-oxidase-like [Cucumis sativus]) HSP 1 Score: 114.8 bits (286), Expect = 7.0e-23 Identity = 53/76 (69.74%), Postives = 63/76 (82.89%), Query Frame = 1
BLAST of CmoCh19G004630 vs. NCBI nr
Match: gi|700205280|gb|KGN60413.1| (hypothetical protein Csa_3G903530 [Cucumis sativus]) HSP 1 Score: 114.8 bits (286), Expect = 7.0e-23 Identity = 53/76 (69.74%), Postives = 63/76 (82.89%), Query Frame = 1
BLAST of CmoCh19G004630 vs. NCBI nr
Match: gi|659134177|ref|XP_008467067.1| (PREDICTED: ent-kaurenoic acid oxidase 2-like, partial [Cucumis melo]) HSP 1 Score: 109.8 bits (273), Expect = 2.3e-21 Identity = 53/77 (68.83%), Postives = 64/77 (83.12%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |