CmoCh19G004450 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACATAATTCATCTTCTAACTGATCTCAACCCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGATCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGACCACGTGAAGACGCTACTCGAATCGGTTCAGCCGGTGTTGTTAGGCGTCAAGCTGTGGATATATCCCCTCTGCGACCCGTTAACCAAGCAATATATCTTCTTACAACTGGTGCTCGTGAAGCTGCCTTTAGAAATATCAAGACAATTGCAGAATGCTTGGCTGATGAACTTATTAATGCAGCAAAGGGTTCATCTAACAGTTACGCTATCAAGAAAAAGGACGAGGTTGAGAGAGTTGCGAAGGCAAATCGGTGA ATGGACATAATTCATCTTCTAACTGATCTCAACCCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGATCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGACCACGTGAAGACGCTACTCGAATCGGTTCAGCCGGTGTTGTTAGGCGTCAAGCTGTGGATATATCCCCTCTGCGACCCGTTAACCAAGCAATATATCTTCTTACAACTGGTGCTCGTGAAGCTGCCTTTAGAAATATCAAGACAATTGCAGAATGCTTGGCTGATGAACTTATTAATGCAGCAAAGGGTTCATCTAACAGTTACGCTATCAAGAAAAAGGACGAGGTTGAGAGAGTTGCGAAGGCAAATCGGTGA ATGGACATAATTCATCTTCTAACTGATCTCAACCCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGATCAATTCAAGTTATTGTTGATGCCGTTGTTAACAGTGGACCACGTGAAGACGCTACTCGAATCGGTTCAGCCGGTGTTGTTAGGCGTCAAGCTGTGGATATATCCCCTCTGCGACCCGTTAACCAAGCAATATATCTTCTTACAACTGGTGCTCGTGAAGCTGCCTTTAGAAATATCAAGACAATTGCAGAATGCTTGGCTGATGAACTTATTAATGCAGCAAAGGGTTCATCTAACAGTTACGCTATCAAGAAAAAGGACGAGGTTGAGAGAGTTGCGAAGGCAAATCGGTGA
BLAST of CmoCh19G004450 vs. Swiss-Prot
Match: RS5_NICPL (40S ribosomal protein S5 (Fragment) OS=Nicotiana plumbaginifolia GN=RPS5 PE=2 SV=1) HSP 1 Score: 185.3 bits (469), Expect = 4.0e-46 Identity = 102/121 (84.30%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. Swiss-Prot
Match: RS51_ARATH (40S ribosomal protein S5-1 OS=Arabidopsis thaliana GN=RPS5A PE=1 SV=1) HSP 1 Score: 184.9 bits (468), Expect = 5.3e-46 Identity = 101/121 (83.47%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. Swiss-Prot
Match: RS5_CICAR (40S ribosomal protein S5 (Fragment) OS=Cicer arietinum GN=RPS5 PE=2 SV=1) HSP 1 Score: 184.9 bits (468), Expect = 5.3e-46 Identity = 103/121 (85.12%), Postives = 106/121 (87.60%), Query Frame = 1
BLAST of CmoCh19G004450 vs. Swiss-Prot
Match: RS52_ARATH (40S ribosomal protein S5-2 OS=Arabidopsis thaliana GN=RPS5B PE=1 SV=2) HSP 1 Score: 184.1 bits (466), Expect = 9.0e-46 Identity = 100/121 (82.64%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. Swiss-Prot
Match: RS5_HUMAN (40S ribosomal protein S5 OS=Homo sapiens GN=RPS5 PE=1 SV=4) HSP 1 Score: 166.0 bits (419), Expect = 2.5e-40 Identity = 90/120 (75.00%), Postives = 101/120 (84.17%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TrEMBL
Match: A0A103YFZ7_CYNCS (Ribosomal protein S5/S7 OS=Cynara cardunculus var. scolymus GN=Ccrd_013215 PE=3 SV=1) HSP 1 Score: 191.4 bits (485), Expect = 6.3e-46 Identity = 103/121 (85.12%), Postives = 111/121 (91.74%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TrEMBL
Match: A0A0A0KSZ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G292230 PE=3 SV=1) HSP 1 Score: 188.7 bits (478), Expect = 4.1e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TrEMBL
Match: A0A0A0LVI4_CUCSA (40S ribosomal protein S5 OS=Cucumis sativus GN=Csa_1G168900 PE=4 SV=1) HSP 1 Score: 188.7 bits (478), Expect = 4.1e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TrEMBL
Match: B9T7U3_RICCO (40S ribosomal protein S5, putative OS=Ricinus communis GN=RCOM_0408940 PE=3 SV=1) HSP 1 Score: 188.7 bits (478), Expect = 4.1e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TrEMBL
Match: A0A0A0K5K0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G232530 PE=3 SV=1) HSP 1 Score: 188.3 bits (477), Expect = 5.3e-45 Identity = 104/121 (85.95%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TAIR10
Match: AT2G37270.1 (AT2G37270.1 ribosomal protein 5B) HSP 1 Score: 184.9 bits (468), Expect = 3.0e-47 Identity = 101/121 (83.47%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. TAIR10
Match: AT3G11940.1 (AT3G11940.1 ribosomal protein 5A) HSP 1 Score: 184.1 bits (466), Expect = 5.1e-47 Identity = 100/121 (82.64%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. NCBI nr
Match: gi|976924441|gb|KVI08405.1| (Ribosomal protein S5/S7 [Cynara cardunculus var. scolymus]) HSP 1 Score: 191.4 bits (485), Expect = 9.0e-46 Identity = 103/121 (85.12%), Postives = 111/121 (91.74%), Query Frame = 1
BLAST of CmoCh19G004450 vs. NCBI nr
Match: gi|449445316|ref|XP_004140419.1| (PREDICTED: 40S ribosomal protein S5 [Cucumis sativus]) HSP 1 Score: 188.7 bits (478), Expect = 5.8e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. NCBI nr
Match: gi|255587562|ref|XP_002534312.1| (PREDICTED: 40S ribosomal protein S5 [Ricinus communis]) HSP 1 Score: 188.7 bits (478), Expect = 5.8e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. NCBI nr
Match: gi|778659522|ref|XP_004139502.2| (PREDICTED: 40S ribosomal protein S5 [Cucumis sativus]) HSP 1 Score: 188.7 bits (478), Expect = 5.8e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
BLAST of CmoCh19G004450 vs. NCBI nr
Match: gi|1009161399|ref|XP_015898876.1| (PREDICTED: 40S ribosomal protein S5 [Ziziphus jujuba]) HSP 1 Score: 188.7 bits (478), Expect = 5.8e-45 Identity = 105/121 (86.78%), Postives = 107/121 (88.43%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|