CmoCh19G000740 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonfive_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.GAAAACAATGTCAGGTAGTAATTTTTAATGCAATGATGTATTGATATTAGTTCAATATGTATTGATATCATTTTATGTATCTAATAAGTATAGATTATATGGTGAAGTTATGTTGAATGAGGAGAAGTGGCGTTGGCCAGAGTTGGTGGGGATGGATGGGGAGGAAGCAATGAAGATAATACAGCAAGAGAATCCTTCTCTCGACGTAATTCTAATGCCACGAGGTCAAAACTGGGCATTTCCCAACTTTGTGTTCAATCGAGTCCGAGTCTTTGTTGACCATTGTGGAAAGGTGAATTCGACCCCTCGAATTGGCTAA GAAAACAATGTCAGTTATGTTGAATGAGGAGAAGTGGCGTTGGCCAGAGTTGGTGGGGATGGATGGGGAGGAAGCAATGAAGATAATACAGCAAGAGAATCCTTCTCTCGACGTAATTCTAATGCCACGAGGTCAAAACTGGGCATTTCCCAACTTTGTGTTCAATCGAGTCCGAGTCTTTGTTGACCATTGTGGAAAGGTGAATTCGACCCCTCGAATTGGCTAA ATGTCAGTTATGTTGAATGAGGAGAAGTGGCGTTGGCCAGAGTTGGTGGGGATGGATGGGGAGGAAGCAATGAAGATAATACAGCAAGAGAATCCTTCTCTCGACGTAATTCTAATGCCACGAGGTCAAAACTGGGCATTTCCCAACTTTGTGTTCAATCGAGTCCGAGTCTTTGTTGACCATTGTGGAAAGGTGAATTCGACCCCTCGAATTGGCTAA
BLAST of CmoCh19G000740 vs. Swiss-Prot
Match: ICI2_HORVU (Subtilisin-chymotrypsin inhibitor-2A OS=Hordeum vulgare PE=1 SV=2) HSP 1 Score: 55.8 bits (133), Expect = 2.2e-07 Identity = 26/64 (40.62%), Postives = 36/64 (56.25%), Query Frame = 1
BLAST of CmoCh19G000740 vs. Swiss-Prot
Match: ICIW_WHEAT (Subtilisin-chymotrypsin inhibitor WSCI OS=Triticum aestivum PE=1 SV=2) HSP 1 Score: 55.5 bits (132), Expect = 2.9e-07 Identity = 25/67 (37.31%), Postives = 38/67 (56.72%), Query Frame = 1
BLAST of CmoCh19G000740 vs. Swiss-Prot
Match: ICI3_HORVU (Subtilisin-chymotrypsin inhibitor-2B (Fragment) OS=Hordeum vulgare PE=2 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.1e-06 Identity = 25/66 (37.88%), Postives = 36/66 (54.55%), Query Frame = 1
BLAST of CmoCh19G000740 vs. Swiss-Prot
Match: ITH5_CUCMA (Inhibitor of trypsin and hageman factor OS=Cucurbita maxima PE=1 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.4e-06 Identity = 26/64 (40.62%), Postives = 39/64 (60.94%), Query Frame = 1
BLAST of CmoCh19G000740 vs. Swiss-Prot
Match: HPI_HEVBR (Protease inhibitor HPI OS=Hevea brasiliensis GN=PI1 PE=1 SV=2) HSP 1 Score: 52.0 bits (123), Expect = 3.2e-06 Identity = 28/61 (45.90%), Postives = 35/61 (57.38%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TrEMBL
Match: Q43421_CUCMA (Pumpkin fruit trypsin inhibitor OS=Cucurbita maxima GN=pfiAF4 PE=2 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 9.3e-21 Identity = 51/65 (78.46%), Postives = 54/65 (83.08%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TrEMBL
Match: Q6DKU8_CUCMA (Putative chymotrypsin protease inhibitor OS=Cucurbita maxima PE=4 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.6e-20 Identity = 51/65 (78.46%), Postives = 54/65 (83.08%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TrEMBL
Match: Q43420_CUCMA (Pumpkin Fruit Chymotrypsin Inhibitor OS=Cucurbita maxima GN=pfiBM7 PE=2 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 7.8e-20 Identity = 51/65 (78.46%), Postives = 53/65 (81.54%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TrEMBL
Match: A0A0K9RNA1_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_047460 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.1e-08 Identity = 35/65 (53.85%), Postives = 45/65 (69.23%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TrEMBL
Match: A0A161XY83_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_010421 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.4e-08 Identity = 30/67 (44.78%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TAIR10
Match: AT5G43580.1 (AT5G43580.1 Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 53.1 bits (126), Expect = 8.0e-08 Identity = 27/72 (37.50%), Postives = 43/72 (59.72%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TAIR10
Match: AT2G38900.2 (AT2G38900.2 Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 47.4 bits (111), Expect = 4.4e-06 Identity = 24/61 (39.34%), Postives = 36/61 (59.02%), Query Frame = 1
BLAST of CmoCh19G000740 vs. TAIR10
Match: AT2G38870.1 (AT2G38870.1 Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 47.4 bits (111), Expect = 4.4e-06 Identity = 24/61 (39.34%), Postives = 37/61 (60.66%), Query Frame = 1
BLAST of CmoCh19G000740 vs. NCBI nr
Match: gi|887420|emb|CAA57307.1| (Pumpkin fruit trypsin inhibitor [Cucurbita maxima]) HSP 1 Score: 107.1 bits (266), Expect = 1.3e-20 Identity = 51/65 (78.46%), Postives = 54/65 (83.08%), Query Frame = 1
BLAST of CmoCh19G000740 vs. NCBI nr
Match: gi|50262213|gb|AAT72726.1| (putative chymotrypsin protease inhibitor [Cucurbita maxima]) HSP 1 Score: 106.3 bits (264), Expect = 2.3e-20 Identity = 51/65 (78.46%), Postives = 54/65 (83.08%), Query Frame = 1
BLAST of CmoCh19G000740 vs. NCBI nr
Match: gi|887418|emb|CAA57203.1| (Pumpkin Fruit Chymotrypsin Inhibitor [Cucurbita maxima]) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 51/65 (78.46%), Postives = 53/65 (81.54%), Query Frame = 1
BLAST of CmoCh19G000740 vs. NCBI nr
Match: gi|902228146|gb|KNA20995.1| (hypothetical protein SOVF_047460 [Spinacia oleracea]) HSP 1 Score: 67.0 bits (162), Expect = 1.5e-08 Identity = 35/65 (53.85%), Postives = 45/65 (69.23%), Query Frame = 1
BLAST of CmoCh19G000740 vs. NCBI nr
Match: gi|1021043886|gb|KZN01667.1| (hypothetical protein DCAR_010421 [Daucus carota subsp. sativus]) HSP 1 Score: 65.9 bits (159), Expect = 3.4e-08 Identity = 30/67 (44.78%), Postives = 46/67 (68.66%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|