CmoCh18G006150 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCCTTAGGCACGGCCATACATAACATAGAAATCATACTTGGGAAGGGGGGACAATTAGCTAGAGCAGCAGGTTCTGTAGCGAAACTGATTGCAAAAGAGGGGAAATTGGCCACATTAAAATTATCTTCTGGGGGGTCCGTTTGATATCAAAAAATTGCTCAACAATAGTCAGACAATTGGGGAATGTTGGGGTAAACCAGAAAAGTTTGGGTAGAGCCGGATCTAAATGTTGACTAGGTAAGCGTCCTATACTAAGAGGAGTAGTTATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGGGTCCCAATTGGTAGAAAAAAACCTGCAACCCCTTGGGGTTATCTTGCACTTGGAAGAAGTAGAAAAAGGAATAAATATAGTGATAATTTTATTCTTCGTCGCCATAGTAAATAA ATGCCCTTAGGCACGGCCATACATAACATAGAAATCATACTTGGGAAGGGGGGACAATTAGCTAGAGCAGCAGGTAAGCGTCCTATACTAAGAGGAGTAGTTATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGGGTCCCAATTGGTAGAAAAAAACCTGCAACCCCTTGGGGTTATCTTGCACTTGGAAGAAGTAGAAAAAGGAATAAATATAGTGATAATTTTATTCTTCGTCGCCATAGTAAATAA ATGCCCTTAGGCACGGCCATACATAACATAGAAATCATACTTGGGAAGGGGGGACAATTAGCTAGAGCAGCAGGTAAGCGTCCTATACTAAGAGGAGTAGTTATGAACCCTGTAGACCATCCCCATGGGGGTGGTGAAGGGAGGGTCCCAATTGGTAGAAAAAAACCTGCAACCCCTTGGGGTTATCTTGCACTTGGAAGAAGTAGAAAAAGGAATAAATATAGTGATAATTTTATTCTTCGTCGCCATAGTAAATAA
BLAST of CmoCh18G006150 vs. Swiss-Prot
Match: RK2_MORIN (50S ribosomal protein L2, chloroplastic OS=Morus indica GN=rpl2-A PE=3 SV=1) HSP 1 Score: 135.2 bits (339), Expect = 3.4e-31 Identity = 78/142 (54.93%), Postives = 80/142 (56.34%), Query Frame = 1
BLAST of CmoCh18G006150 vs. Swiss-Prot
Match: RK2_MANES (50S ribosomal protein L2, chloroplastic OS=Manihot esculenta GN=rpl2-A PE=3 SV=1) HSP 1 Score: 135.2 bits (339), Expect = 3.4e-31 Identity = 78/142 (54.93%), Postives = 80/142 (56.34%), Query Frame = 1
BLAST of CmoCh18G006150 vs. Swiss-Prot
Match: RK2_CUCSA (50S ribosomal protein L2, chloroplastic OS=Cucumis sativus GN=rpl2-A PE=3 SV=1) HSP 1 Score: 135.2 bits (339), Expect = 3.4e-31 Identity = 78/142 (54.93%), Postives = 80/142 (56.34%), Query Frame = 1
BLAST of CmoCh18G006150 vs. Swiss-Prot
Match: RK2_CARPA (50S ribosomal protein L2, chloroplastic OS=Carica papaya GN=rpl2-A PE=3 SV=1) HSP 1 Score: 135.2 bits (339), Expect = 3.4e-31 Identity = 78/142 (54.93%), Postives = 80/142 (56.34%), Query Frame = 1
BLAST of CmoCh18G006150 vs. Swiss-Prot
Match: RK2B_POPAL (50S ribosomal protein L2-B, chloroplastic OS=Populus alba GN=rpl2-B PE=3 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.5e-31 Identity = 77/142 (54.23%), Postives = 80/142 (56.34%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TrEMBL
Match: G7JH62_MEDTR (50S ribosomal protein L2 OS=Medicago truncatula GN=MTR_4g051430 PE=3 SV=1) HSP 1 Score: 140.6 bits (353), Expect = 8.9e-31 Identity = 76/122 (62.30%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TrEMBL
Match: A0A0S2IE39_9ROSI (Ribosomal protein L2 OS=Cucurbita argyrosperma GN=rpl2 PE=3 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 7.6e-30 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TrEMBL
Match: A0A0S2IEF6_9ROSI (Ribosomal protein L2 OS=Cucurbita cordata GN=rpl2 PE=3 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 7.6e-30 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TrEMBL
Match: A0A0S2IF81_9ROSI (Ribosomal protein L2 OS=Cucurbita foetidissima GN=rpl2 PE=3 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 7.6e-30 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TrEMBL
Match: A0A0S2IGF8_CUCPE (Ribosomal protein L2 OS=Cucurbita pepo subsp. fraterna GN=rpl2 PE=3 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 7.6e-30 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TAIR10
Match: ATCG00830.1 (ATCG00830.1 ribosomal protein L2) HSP 1 Score: 125.2 bits (313), Expect = 2.0e-29 Identity = 72/142 (50.70%), Postives = 77/142 (54.23%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TAIR10
Match: ATCG01310.1 (ATCG01310.1 ribosomal protein L2) HSP 1 Score: 125.2 bits (313), Expect = 2.0e-29 Identity = 72/142 (50.70%), Postives = 77/142 (54.23%), Query Frame = 1
BLAST of CmoCh18G006150 vs. TAIR10
Match: AT2G44065.1 (AT2G44065.1 Ribosomal protein L2 family) HSP 1 Score: 50.1 bits (118), Expect = 8.0e-07 Identity = 27/51 (52.94%), Postives = 31/51 (60.78%), Query Frame = 1
BLAST of CmoCh18G006150 vs. NCBI nr
Match: gi|357471553|ref|XP_003606061.1| (50S ribosomal protein L2 [Medicago truncatula]) HSP 1 Score: 140.6 bits (353), Expect = 1.3e-30 Identity = 76/122 (62.30%), Postives = 80/122 (65.57%), Query Frame = 1
BLAST of CmoCh18G006150 vs. NCBI nr
Match: gi|952954360|gb|ALO21724.1| (ribosomal protein L2 (plastid) [Cucurbita argyrosperma]) HSP 1 Score: 137.5 bits (345), Expect = 1.1e-29 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. NCBI nr
Match: gi|788229612|ref|YP_009123784.1| (ribosomal protein L2 [Lithocarpus balansae]) HSP 1 Score: 137.5 bits (345), Expect = 1.1e-29 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. NCBI nr
Match: gi|408902749|gb|AFU96017.1| (Rpl2, partial (chloroplast) [Balanops pachyphylla]) HSP 1 Score: 136.7 bits (343), Expect = 1.9e-29 Identity = 79/142 (55.63%), Postives = 81/142 (57.04%), Query Frame = 1
BLAST of CmoCh18G006150 vs. NCBI nr
Match: gi|340806857|gb|AEK71496.1| (ribosomal protein L2 [Krameria lanceolata]) HSP 1 Score: 136.7 bits (343), Expect = 1.9e-29 Identity = 78/142 (54.93%), Postives = 81/142 (57.04%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|